Human PTPN11/BPTP3/CFC ORF/cDNA clone-Lentivirus plasmid (NM_002834.5)

SKU: pGMLV002452
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PTPN11/BPTP3/CFC Lentiviral expression plasmid for PTPN11 lentivirus packaging, PTPN11 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf MSDS
pdf Datasheet
pdf Terms of Use
Target products collection

Go to PTPN11/BPTP3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $852.42
Shipping fee: Limited-time free


Product Description

Catalog ID pGMLV002452
Gene Name PTPN11
Accession Number NM_002834.5
Gene ID 5781
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1782 bp
Gene Alias BPTP3,CFC,JMML,METCDS,NS1,PTP-1D,PTP2C,SH-PTP2,SH-PTP3,SHP2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
Sequence ATGACATCGCGGAGATGGTTTCACCCAAATATCACTGGTGTGGAGGCAGAAAACCTACTGTTGACAAGAGGAGTTGATGGCAGTTTTTTGGCAAGGCCTAGTAAAAGTAACCCTGGAGACTTCACACTTTCCGTTAGAAGAAATGGAGCTGTCACCCACATCAAGATTCAGAACACTGGTGATTACTATGACCTGTATGGAGGGGAGAAATTTGCCACTTTGGCTGAGTTGGTCCAGTATTACATGGAACATCACGGGCAATTAAAAGAGAAGAATGGAGATGTCATTGAGCTTAAATATCCTCTGAACTGTGCAGATCCTACCTCTGAAAGGTGGTTTCATGGACATCTCTCTGGGAAAGAAGCAGAGAAATTATTAACTGAAAAAGGAAAACATGGTAGTTTTCTTGTACGAGAGAGCCAGAGCCACCCTGGAGATTTTGTTCTTTCTGTGCGCACTGGTGATGACAAAGGGGAGAGCAATGACGGCAAGTCTAAAGTGACCCATGTTATGATTCGCTGTCAGGAACTGAAATACGACGTTGGTGGAGGAGAACGGTTTGATTCTTTGACAGATCTTGTGGAACATTATAAGAAGAATCCTATGGTGGAAACATTGGGTACAGTACTACAACTCAAGCAGCCCCTTAACACGACTCGTATAAATGCTGCTGAAATAGAAAGCAGAGTTCGAGAACTAAGCAAATTAGCTGAGACCACAGATAAAGTCAAACAAGGCTTTTGGGAAGAATTTGAGACACTACAACAACAGGAGTGCAAACTTCTCTACAGCCGAAAAGAGGGTCAAAGGCAAGAAAACAAAAACAAAAATAGATATAAAAACATCCTGCCCTTTGATCATACCAGGGTTGTCCTACACGATGGTGATCCCAATGAGCCTGTTTCAGATTACATCAATGCAAATATCATCATGCCTGAATTTGAAACCAAGTGCAACAATTCAAAGCCCAAAAAGAGTTACATTGCCACACAAGGCTGCCTGCAAAACACGGTGAATGACTTTTGGCGGATGGTGTTCCAAGAAAACTCCCGAGTGATTGTCATGACAACGAAAGAAGTGGAGAGAGGAAAGAGTAAATGTGTCAAATACTGGCCTGATGAGTATGCTCTAAAAGAATATGGCGTCATGCGTGTTAGGAACGTCAAAGAAAGCGCCGCTCATGACTATACGCTAAGAGAACTTAAACTTTCAAAGGTTGGACAAGGGAATACGGAGAGAACGGTCTGGCAATACCACTTTCGGACCTGGCCGGACCACGGCGTGCCCAGCGACCCTGGGGGCGTGCTGGACTTCCTGGAGGAGGTGCACCATAAGCAGGAGAGCATCATGGATGCAGGGCCGGTCGTGGTGCACTGCAGTGCTGGAATTGGCCGGACAGGGACGTTCATTGTGATTGATATTCTTATTGACATCATCAGAGAGAAAGGTGTTGACTGCGATATTGACGTTCCCAAAACCATCCAGATGGTGCGGTCTCAGAGGTCAGGGATGGTCCAGACAGAAGCACAGTACCGATTTATCTATATGGCGGTCCAGCATTATATTGAAACACTACAGCGCAGGATTGAAGAAGAGCAGAAAAGCAAGAGGAAAGGGCACGAATATACAAATATTAAGTATTCTCTAGCGGACCAGACGAGTGGAGATCAGAGCCCTCTCCCGCCTTGTACTCCAACGCCACCCTGTGCAGAAATGAGAGAAGACAGTGCTAGAGTCTATGAAAACGTGGGCCTGATGCAACAGCAGAAAAGTTTCAGATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T13057-Ab Anti-PTPN11 monoclonal antibody
    Target Antigen GM-Tg-g-T13057-Ag PTPN11 protein
    ORF Viral Vector pGMLV000276 Human PTPN11 Lentivirus plasmid
    ORF Viral Vector pGMLV002132 Human PTPN11 Lentivirus plasmid
    ORF Viral Vector pGMLV002452 Human PTPN11 Lentivirus plasmid
    ORF Viral Vector pGMAD000149 Human PTPN11 Adenovirus plasmid
    ORF Viral Vector pGMPC001341 Human PTPN11 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000276 Human PTPN11 Lentivirus particle
    ORF Viral Vector vGMLV002132 Human PTPN11 Lentivirus particle
    ORF Viral Vector vGMLV002452 Human PTPN11 Lentivirus particle
    ORF Viral Vector vGMAD000149 Human PTPN11 Adenovirus particle


    Target information

    Target ID GM-T13057
    Target Name PTPN11
    Gene ID 5781, 19247, 712044, 25622, 101085500, 477488, 533590, 100056857
    Gene Symbol and Synonyms 2700084A17Rik,BPTP3,CFC,JMML,METCDS,NS1,PTP-1D,PTP1D,PTP2C,PTPN11,SAP-2,SH-PTP2,SH-PTP3,SHP-2,SHP2,Syp
    Uniprot Accession Q06124
    Uniprot Entry Name PTN11_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Breast Cancer
    Gene Ensembl ENSG00000179295
    Target Classification Not Available

    The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains two tandem Src homology-2 domains, which function as phospho-tyrosine binding domains and mediate the interaction of this PTP with its substrates. This PTP is widely expressed in most tissues and plays a regulatory role in various cell signaling events that are important for a diversity of cell functions, such as mitogenic activation, metabolic control, transcription regulation, and cell migration. Mutations in this gene are a cause of Noonan syndrome as well as acute myeloid leukemia. [provided by RefSeq, Aug 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.