Human CCN2/CTGF/HCS24 ORF/cDNA clone-Lentivirus plasmid (NM_001901)

Cat. No.: pGMLV002243
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CCN2/CTGF/HCS24 Lentiviral expression plasmid for CCN2 lentivirus packaging, CCN2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CTGF/CCN2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $594
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV002243
Gene Name CCN2
Accession Number NM_001901
Gene ID 1490
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1050 bp
Gene Alias CTGF,HCS24,IGFBP8,NOV2
Fluorescent Reporter null
Mammalian Cell Selection Neomycin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACCGCCGCCAGTATGGGCCCCGTCCGCGTCGCCTTCGTGGTCCTCCTCGCCCTCTGCAGCCGGCCGGCCGTCGGCCAGAACTGCAGCGGGCCGTGCCGGTGCCCGGACGAGCCGGCGCCGCGCTGCCCGGCGGGCGTGAGCCTCGTGCTGGACGGCTGCGGCTGCTGCCGCGTCTGCGCCAAGCAGCTGGGCGAGCTGTGCACCGAGCGCGACCCATGCGACCCGCACAAGGGCCTATTCTGTCACTTCGGCTCCCCGGCCAACCGCAAGATCGGCGTGTGCACCGCCAAAGATGGTGCTCCCTGCATCTTCGGTGGTACGGTGTACCGCAGCGGAGAGTCCTTCCAGAGCAGCTGCAAGTACCAGTGCACGTGCCTGGACGGGGCGGTGGGCTGCATGCCCCTGTGCAGCATGGACGTTCGTCTGCCCAGCCCTGACTGCCCCTTCCCGAGGAGGGTCAAGCTGCCCGGGAAATGCTGCGAGGAGTGGGTGTGTGACGAGCCCAAGGACCAAACCGTGGTTGGGCCTGCCCTCGCGGCTTACCGACTGGAAGACACGTTTGGCCCAGACCCAACTATGATTAGAGCCAACTGCCTGGTCCAGACCACAGAGTGGAGCGCCTGTTCCAAGACCTGTGGGATGGGCATCTCCACCCGGGTTACCAATGACAACGCCTCCTGCAGGCTAGAGAAGCAGAGCCGCCTGTGCATGGTCAGGCCTTGCGAAGCTGACCTGGAAGAGAACATTAAGAAGGGCAAAAAGTGCATCCGTACTCCCAAAATCTCCAAGCCTATCAAGTTTGAGCTTTCTGGCTGCACCAGCATGAAGACATACCGAGCTAAATTCTGTGGAGTATGTACCGACGGCCGATGCTGCACCCCCCACAGAACCACCACCCTGCCGGTGGAGTTCAAGTGCCCTGACGGCGAGGTCATGAAGAAGAACATGATGTTCATCAAGACCTGTGCCTGCCATTACAACTGTCCCGGAGACAATGACATCTTTGAATCGCTGTACTACAGGAAGATGTACGGAGACATGGCATGA
ORF Protein Sequence MTAASMGPVRVAFVVLLALCSRPAVGQNCSGPCRCPDEPAPRCPAGVSLVLDGCGCCRVCAKQLGELCTERDPCDPHKGLFCHFGSPANRKIGVCTAKDGAPCIFGGTVYRSGESFQSSCKYQCTCLDGAVGCMPLCSMDVRLPSPDCPFPRRVKLPGKCCEEWVCDEPKDQTVVGPALAAYRLEDTFGPDPTMIRANCLVQTTEWSACSKTCGMGISTRVTNDNASCRLEKQSRLCMVRPCEADLEENIKKGKKCIRTPKISKPIKFELSGCTSMKTYRAKFCGVCTDGRCCTPHRTTTLPVEFKCPDGEVMKKNMMFIKTCACHYNCPGDNDIFESLYYRKMYGDMA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-424 Pre-Made Pamrevlumab biosimilar, Whole mAb, Anti-CTGF/CCN2 Antibody: Anti-HCS24/IGFBP8/NOV2 therapeutic antibody
    Target Antibody GM-Tg-g-T50444-Ab Anti-CCN2/ CTGF/ HCS24 monoclonal antibody
    Target Antigen GM-Tg-g-T50444-Ag CTGF/CCN2 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T50444 connective tissue growth factor (CTGF) protein & antibody
    ORF Viral Vector pGMLV001357 Human CTGF Lentivirus plasmid
    ORF Viral Vector pGMLV002243 Human CCN2 Lentivirus plasmid
    ORF Viral Vector pGMLV002442 Human CCN2 Lentivirus plasmid
    ORF Viral Vector pGMAD000129 Human CTGF Adenovirus plasmid
    ORF Viral Vector pGMAD001305 Human CCN2 Adenovirus plasmid
    ORF Viral Vector pGMPC000028 Human CTGF Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV001357 Human CTGF Lentivirus particle
    ORF Viral Vector vGMLV002243 Human CCN2 Lentivirus particle
    ORF Viral Vector vGMLV002442 Human CCN2 Lentivirus particle
    ORF Viral Vector vGMAD000129 Human CTGF Adenovirus particle
    ORF Viral Vector vGMAD001305 Human CCN2 Adenovirus particle


    Target information

    Target ID GM-T50444
    Target Name CTGF
    Gene ID 1490, 14219, 714520, 64032, 101094598, 476202, 281103, 100073098
    Gene Symbol and Synonyms CCN2,CTGF,CTGRP,fisp-12,Fisp12,HCS24,IGFBP8,NOV2
    Uniprot Accession P29279
    Uniprot Entry Name CCN2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index, Cytokine Target
    Disease Ovary Cancer, Chronic Kidney Disease, Type 1 diabetes mellitus with diabetic nephropathy, gastric cancer, Complications of kidney transplant
    Gene Ensembl ENSG00000118523
    Target Classification Not Available

    The protein encoded by this gene is a mitogen that is secreted by vascular endothelial cells. The encoded protein plays a role in chondrocyte proliferation and differentiation, cell adhesion in many cell types, and is related to platelet-derived growth factor. Certain polymorphisms in this gene have been linked with a higher incidence of systemic sclerosis. [provided by RefSeq, Nov 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.