Human PTGDR2/CD294/CRTH2 ORF/cDNA clone-Lentivirus plasmid (NM_004778.3)

Cat. No.: pGMLV001009
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PTGDR2/CD294/CRTH2 Lentiviral expression plasmid for PTGDR2 lentivirus packaging, PTGDR2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to PTGDR2/CD294 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $632.64
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV001009
Gene Name PTGDR2
Accession Number NM_004778.3
Gene ID 11251
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1188 bp
Gene Alias CD294,CRTH2,DL1R,DP2,GPR44
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCGGCCAACGCCACACTGAAGCCACTCTGCCCCATCCTGGAGCAGATGAGCCGTCTCCAGAGCCACAGCAACACCAGCATCCGCTACATCGACCACGCGGCCGTGCTGCTGCACGGGCTGGCCTCGCTGCTGGGCCTGGTGGAGAATGGAGTCATCCTCTTCGTGGTGGGCTGCCGCATGCGCCAGACCGTGGTCACCACCTGGGTGCTGCACCTGGCGCTGTCCGACCTGTTGGCCTCTGCTTCCCTGCCCTTCTTCACCTACTTCTTGGCCGTGGGCCACTCGTGGGAGCTGGGCACCACCTTCTGCAAACTGCACTCCTCCATCTTCTTTCTCAACATGTTCGCCAGCGGCTTCCTGCTCAGCGCCATCAGCCTGGACCGCTGCCTGCAGGTGGTGCGGCCGGTGTGGGCGCAGAACCACCGCACCGTGGCCGCGGCGCACAAAGTCTGCCTGGTGCTTTGGGCACTAGCGGTGCTCAACACGGTGCCCTATTTCGTGTTCCGGGACACCATCTCGCGGCTGGACGGGCGCATTATGTGCTACTACAATGTGCTGCTCCTGAACCCGGGGCCTGACCGCGATGCCACGTGCAACTCGCGGCAGGTGGCCCTGGCCGTCAGCAAGTTCCTGCTGGCCTTCCTGGTGCCGCTGGCGATCATCGCCTCGAGCCACGCGGCCGTGAGCCTGCGGTTGCAGCACCGCGGCCGCCGGCGGCCAGGCCGCTTCGTGCGCCTGGTGGCGGCCGTCGTGGCCGCCTTCGCGCTCTGCTGGGGGCCCTACCACGTGTTCAGCCTGCTGGAGGCGCGGGCGCACGCAAACCCGGGGCTGCGGCCGCTCGTGTGGCGCGGGCTGCCCTTCGTCACCAGCCTGGCCTTCTTCAACAGCGTGGCCAACCCGGTGCTCTACGTGCTCACCTGCCCCGACATGCTGCGCAAGCTGCGGCGCTCGCTGCGCACGGTGCTGGAGAGCGTGCTGGTGGACGACAGCGAGCTGGGTGGCGCGGGAAGCAGCCGCCGCCGCCGCACCTCCTCCACCGCCCGCTCGGCCTCCCCTTTAGCTCTCTGCAGCCGCCCGGAGGAACCGCGGGGCCCCGCGCGTCTCCTCGGCTGGCTGCTGGGCAGCTGCGCAGCGTCCCCGCAGACGGGCCCCCTGAACCGGGCGCTGAGCAGCACCTCGAGTTAG
ORF Protein Sequence MSANATLKPLCPILEQMSRLQSHSNTSIRYIDHAAVLLHGLASLLGLVENGVILFVVGCRMRQTVVTTWVLHLALSDLLASASLPFFTYFLAVGHSWELGTTFCKLHSSIFFLNMFASGFLLSAISLDRCLQVVRPVWAQNHRTVAAAHKVCLVLWALAVLNTVPYFVFRDTISRLDGRIMCYYNVLLLNPGPDRDATCNSRQVALAVSKFLLAFLVPLAIIASSHAAVSLRLQHRGRRRPGRFVRLVAAVVAAFALCWGPYHVFSLLEARAHANPGLRPLVWRGLPFVTSLAFFNSVANPVLYVLTCPDMLRKLRRSLRTVLESVLVDDSELGGAGSSRRRRTSSTARSASPLALCSRPEEPRGPARLLGWLLGSCAASPQTGPLNRALSSTSS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T61722-Ab Anti-PD2R2/ PTGDR2/ CD294 monoclonal antibody
    Target Antigen GM-Tg-g-T61722-Ag PTGDR2 VLP (virus-like particle)
    ORF Viral Vector pGMLP004450 Human PTGDR2 Lentivirus plasmid
    ORF Viral Vector pGMLV001009 Human PTGDR2 Lentivirus plasmid
    ORF Viral Vector vGMLP004450 Human PTGDR2 Lentivirus particle
    ORF Viral Vector vGMLV001009 Human PTGDR2 Lentivirus particle


    Target information

    Target ID GM-T61722
    Target Name PTGDR2
    Gene ID 11251, 14764, 695853, 309212, 101081756, 483805, 337885, 100061935
    Gene Symbol and Synonyms CD294,CRTH2,DL1R,DP2,GPR44,Grp45,PTGDR2
    Uniprot Accession Q9Y5Y4
    Uniprot Entry Name PD2R2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000183134
    Target Classification GPCR

    This gene encodes a G-protein-coupled receptor that is preferentially expressed in CD4+ effector T helper 2 (Th2) cells. This protein is a prostaglandin D2 receptor that mediates the pro-inflammatory chemotaxis of eosinophils, basophils, and Th2 lymphocytes generated during allergic inflammation. Single nucleotide polymorphisms in the 3' UTR of this gene have been associated with asthma susceptibility.[provided by RefSeq, Mar 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.