Human HLA-G/MHC-G ORF/cDNA clone-Lentivirus plasmid (NM_001363567)

Pre-made Human HLA-G/MHC-G Lentiviral expression plasmid for HLA-G lentivirus packaging, HLA-G lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to HLA-G/MHC-G products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLV000935 Human HLA-G Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLV000935
Gene Name HLA-G
Accession Number NM_001363567
Gene ID 3135
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1032 bp
Gene Alias MHC-G
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocinmyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGACGCCAAGGATGGTGGTCATGGCGCCCCGAACCCTCTTCCTGCTGCTCTCGGGGGCCCTGACCCTGACCGAGACCTGGGCGGGCTCCCACTCCATGAGGTATTTCAGCGCCGCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCATGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACTCGGCGTGTCCGAGGATGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGAAGAGGAGACACGGAACACCAAGGCCCACGCACAGACTGACAGAATGAACCTGCAGACCCTGCGCGGCTACTACAACCAGAGCGAGGCCAGTTCTCACACCCTCCAGTGGATGATTGGCTGCGACCTGGGGTCCGACGGACGCCTCCTCCGCGGGTATGAACAGTATGCCTACGATGGCAAGGATTACCTCGCCCTGAACGAGGACCTGCGCTCCTGGACCGCAGCGGACACTGCGGCTCAGATCTCCAAGCGCAAGTGTGAGGCGGCCAATGTGGCTGAACAAAGGAGAGCCTACCTGGAGGGCACGTGCGTGGAGTGGCTCCACAGATACCTGGAGAACGGGAAGGAGATGCTGCAGCGCGCGGACCCCCCCAAGACACACGTGACCCACCACCCTGTCTTTGACTATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGATCATACTGACCTGGCAGCGGGATGGGGAGGACCAGACCCAGGACGTGGAGCTCGTGGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGAAGTGGGCAGCTGTGGTGGTGCCTTCTGGAGAGGAGCAGAGATACACGTGCCATGTGCAGCATGAGGGGCTGCCGGAGCCCCTCATGCTGAGATGGAAGCAGTCTTCCCTGCCCACCATCCCCATCATGGGTATCGTTGCTGGCCTGGTTGTCCTTGCAGCTGTAGTCACTGGAGCTGCGGTCGCTGCTGTGCTGTGGAGAAAGAAGAGCTCAGATTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0590-Ab Anti-HLAG/ HLA-G/ MHC-G monoclonal antibody
    Target Antigen GM-Tg-g-MP0590-Ag HLA-G VLP (virus-like particle)
    ORF Viral Vector pGMLV000304 Human HLA-G Lentivirus plasmid
    ORF Viral Vector pGMLV000935 Human HLA-G Lentivirus plasmid
    ORF Viral Vector vGMLV000304 Human HLA-G Lentivirus particle
    ORF Viral Vector vGMLV000935 Human HLA-G Lentivirus particle


    Target information

    Target ID GM-MP0590
    Target Name HLA-G
    Gene ID 3135
    Gene Symbol and Synonyms HLA-G,MHC-G
    Uniprot Accession P17693
    Uniprot Entry Name HLAG_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Prostate Cancer
    Gene Ensembl ENSG00000204632
    Target Classification Not Available

    HLA-G belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. HLA-G is expressed on fetal derived placental cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the alpha1 and alpha2 domain, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region, and exon 6 encodes the cytoplasmic tail. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.