Human CTH ORF/cDNA clone-Lentivirus plasmid (NM_001902.6)

Pre-made Human CTH/ Lentiviral expression plasmid for CTH lentivirus packaging, CTH lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CTH/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLV000886 Human CTH Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLV000886
Gene Name CTH
Accession Number NM_001902.6
Gene ID 1491
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1218 bp
Gene Alias
Fluorescent Reporter mCherry
Mammalian Cell Selection Puromyocinmyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCAGGAAAAAGACGCCTCCTCACAAGGTTTCCTGCCACACTTCCAACATTTCGCCACGCAGGCGATCCATGTGGGCCAGGATCCAGAGCAATGGACCTCCAGGGCTGTAGTGCCCCCCATCTCACTGTCCACCACGTTCAAGCAAGGGGCGCCTGGCCAGCACTCGGGTTTTGAATATAGCCGTTCTGGAAATCCCACTAGGAATTGCCTTGAAAAAGCAGTGGCAGCACTGGATGGGGCTAAGTACTGTTTGGCCTTTGCTTCAGGTTTAGCAGCCACTGTAACTATTACCCATCTTTTAAAAGCAGGAGACCAAATTATTTGTATGGATGATGTGTATGGAGGTACAAACAGGTACTTCAGGCAAGTGGCATCTGAATTTGGATTAAAGATTTCTTTTGTTGATTGTTCCAAAATCAAATTACTAGAGGCAGCAATTACACCAGAAACCAAGCTTGTTTGGATCGAAACCCCCACAAACCCCACCCAGAAGGTGATTGACATTGAAGGCTGTGCACATATTGTCCATAAGCATGGAGACATTATTTTGGTCGTGGATAACACTTTTATGTCACCATATTTCCAGCGCCCTTTGGCTCTGGGAGCTGATATTTCTATGTATTCTGCAACAAAATACATGAATGGCCACAGTGATGTTGTAATGGGCCTGGTGTCTGTTAATTGTGAAAGCCTTCATAATAGACTTCGTTTCTTGCAAAACTCTCTTGGAGCAGTTCCATCTCCTATTGATTGTTACCTCTGCAATCGAGGTCTGAAGACTCTACATGTCCGAATGGAAAAGCATTTCAAAAACGGAATGGCAGTTGCCCAGTTCCTGGAATCTAATCCTTGGGTAGAAAAGGTTATTTATCCTGGGCTGCCCTCTCATCCACAGCATGAGTTGGTGAAGCGTCAGTGTACAGGTTGTACAGGGATGGTCACCTTTTATATTAAGGGCACTCTTCAGCATGCTGAGATTTTCCTCAAGAACCTAAAGCTATTTACTCTGGCCGAGAGCTTGGGAGGATTCGAAAGCCTTGCTGAGCTTCCGGCAATCATGACTCATGCATCAGTTCTTAAGAATGACAGAGATGTCCTTGGAATTAGTGACACACTGATTCGACTTTCTGTGGGCTTAGAGGATGAGGAAGACCTACTGGAAGATCTAGATCAAGCTTTGAAGGCAGCACACCCTCCAAGTGGAAGTCACAGCTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T12241-Ab Anti-CTH monoclonal antibody
    Target Antigen GM-Tg-g-T12241-Ag CTH protein
    ORF Viral Vector pGMLV000312 Human CTH Lentivirus plasmid
    ORF Viral Vector pGMLV000886 Human CTH Lentivirus plasmid
    ORF Viral Vector vGMLV000312 Human CTH Lentivirus particle
    ORF Viral Vector vGMLV000886 Human CTH Lentivirus particle


    Target information

    Target ID GM-T12241
    Target Name CTH
    Gene ID 1491, 107869, 696664, 24962, 101083282, 479991, 539159, 100053614
    Gene Symbol and Synonyms 0610010I13Rik,CGL,CSE,CTH,Cys3
    Uniprot Accession P32929
    Uniprot Entry Name CGL_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000116761
    Target Classification Not Available

    This gene encodes a cytoplasmic enzyme in the trans-sulfuration pathway that converts cystathione derived from methionine into cysteine. Glutathione synthesis in the liver is dependent upon the availability of cysteine. Mutations in this gene cause cystathioninuria. Alternative splicing of this gene results in three transcript variants encoding different isoforms. [provided by RefSeq, Jun 2010]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.