Human KCNN4/DHS2/hIKCa1 ORF/cDNA clone-Lentivirus plasmid (NM_002250)

Cat. No.: pGMLV000498
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human KCNN4/DHS2/hIKCa1 Lentiviral expression plasmid for KCNN4 lentivirus packaging, KCNN4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to KCNN4/DHS2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $659.52
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV000498
Gene Name KCNN4
Accession Number NM_002250
Gene ID 3783
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1284 bp
Gene Alias DHS2,hIKCa1,hKCa4,hSK4,IK,IK1,IKCA1,KCa3.1,KCA4,SK4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGCGGGGATCTGGTGCTTGGCCTGGGGGCCTTGAGACGCCGAAAGCGCTTGCTGGAGCAGGAGAAGTCTCTGGCCGGCTGGGCACTGGTGCTGGCAGGAACTGGCATTGGACTCATGGTGCTGCATGCAGAGATGCTGTGGTTCGGGGGGTGCTCGTGGGCGCTCTACCTGTTCCTGGTTAAATGCACGATCAGCATTTCCACCTTCTTACTCCTCTGCCTCATCGTGGCCTTTCATGCCAAAGAGGTCCAGCTGTTCATGACCGACAACGGGCTGCGGGACTGGCGCGTGGCGCTGACCGGGCGGCAGGCGGCGCAGATCGTGCTGGAGCTGGTGGTGTGTGGGCTGCACCCGGCGCCCGTGCGGGGCCCGCCGTGCGTGCAGGATTTAGGGGCGCCGCTGACCTCCCCGCAGCCCTGGCCGGGATTCCTGGGCCAAGGGGAAGCGCTGCTGTCCCTGGCCATGCTGCTGCGTCTCTACCTGGTGCCCCGCGCCGTGCTCCTGCGCAGCGGCGTCCTGCTCAACGCTTCCTACCGCAGCATCGGCGCTCTCAATCAAGTCCGCTTCCGCCACTGGTTCGTGGCCAAGCTTTACATGAACACGCACCCTGGCCGCCTGCTGCTCGGCCTCACGCTTGGCCTCTGGCTGACCACCGCCTGGGTGCTGTCCGTGGCCGAGAGGCAGGCTGTTAATGCCACTGGGCACCTTTCAGACACACTTTGGCTGATCCCCATCACATTCCTGACCATCGGCTATGGTGACGTGGTGCCGGGCACCATGTGGGGCAAGATCGTCTGCCTGTGCACTGGAGTCATGGGTGTCTGCTGCACAGCCCTGCTGGTGGCCGTGGTGGCCCGGAAGCTGGAGTTTAACAAGGCAGAGAAGCACGTGCACAACTTCATGATGGATATCCAGTATACCAAAGAGATGAAGGAGTCCGCTGCCCGAGTGCTACAAGAAGCCTGGATGTTCTACAAACATACTCGCAGGAAGGAGTCTCATGCTGCCCGCAGGCATCAGCGCAAGCTGCTGGCCGCCATCAACGCGTTCCGCCAGGTGCGGCTGAAACACCGGAAGCTCCGGGAACAAGTGAACTCCATGGTGGACATCTCCAAGATGCACATGATCCTGTATGACCTGCAGCAGAATCTGAGCAGCTCACACCGGGCCCTGGAGAAACAGATTGACACGCTGGCGGGGAAGCTGGATGCCCTGACTGAGCTGCTTAGCACTGCCCTGGGGCCGAGGCAGCTTCCAGAACCCAGCCAGCAGTCCAAGTAG
ORF Protein Sequence MGGDLVLGLGALRRRKRLLEQEKSLAGWALVLAGTGIGLMVLHAEMLWFGGCSWALYLFLVKCTISISTFLLLCLIVAFHAKEVQLFMTDNGLRDWRVALTGRQAAQIVLELVVCGLHPAPVRGPPCVQDLGAPLTSPQPWPGFLGQGEALLSLAMLLRLYLVPRAVLLRSGVLLNASYRSIGALNQVRFRHWFVAKLYMNTHPGRLLLGLTLGLWLTTAWVLSVAERQAVNATGHLSDTLWLIPITFLTIGYGDVVPGTMWGKIVCLCTGVMGVCCTALLVAVVARKLEFNKAEKHVHNFMMDIQYTKEMKESAARVLQEAWMFYKHTRRKESHAARRHQRKLLAAINAFRQVRLKHRKLREQVNSMVDISKMHMILYDLQQNLSSSHRALEKQIDTLAGKLDALTELLSTALGPRQLPEPSQQSK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T42724-Ab Anti-KCNN4/ DHS2/ IK monoclonal antibody
    Target Antigen GM-Tg-g-T42724-Ag KCNN4 VLP (virus-like particle)
    ORF Viral Vector pGMLV000294 Human KCNN4 Lentivirus plasmid
    ORF Viral Vector pGMLV000498 Human KCNN4 Lentivirus plasmid
    ORF Viral Vector vGMLV000294 Human KCNN4 Lentivirus particle
    ORF Viral Vector vGMLV000498 Human KCNN4 Lentivirus particle


    Target information

    Target ID GM-T42724
    Target Name KCNN4
    Gene ID 3783, 16534, 712383, 65206, 101090475, 484464, 534591, 100147493
    Gene Symbol and Synonyms DHS2,hIKCa1,hKCa4,hSK4,IK,IK1,IKCA1,KCa3.1,KCA4,KCNN4,mIKCa1,rKCNN4c,rSK4,SK4,SKCas
    Uniprot Accession O15554
    Uniprot Entry Name KCNN4_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000104783
    Target Classification Not Available

    The protein encoded by this gene is part of a potentially heterotetrameric voltage-independent potassium channel that is activated by intracellular calcium. Activation is followed by membrane hyperpolarization, which promotes calcium influx. The encoded protein may be part of the predominant calcium-activated potassium channel in T-lymphocytes. This gene is similar to other KCNN family potassium channel genes, but it differs enough to possibly be considered as part of a new subfamily. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.