Human RAD51/BRCC5/FANCR ORF/cDNA clone-Lentivirus plasmid (NM_002875)

Cat. No.: pGMLV000274
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human RAD51/BRCC5/FANCR Lentiviral expression plasmid for RAD51 lentivirus packaging, RAD51 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to RAD51/BRCC5 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $585.6
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV000274
Gene Name RAD51
Accession Number NM_002875
Gene ID 5888
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1020 bp
Gene Alias BRCC5,FANCR,HRAD51,HsRad51,HsT16930,MRMV2,RAD51A,RECA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCAATGCAGATGCAGCTTGAAGCAAATGCAGATACTTCAGTGGAAGAAGAAAGCTTTGGCCCACAACCCATTTCACGGTTAGAGCAGTGTGGCATAAATGCCAACGATGTGAAGAAATTGGAAGAAGCTGGATTCCATACTGTGGAGGCTGTTGCCTATGCGCCAAAGAAGGAGCTAATAAATATTAAGGGAATTAGTGAAGCCAAAGCTGATAAAATTCTGGCTGAGGCAGCTAAATTAGTTCCAATGGGTTTCACCACTGCAACTGAATTCCACCAAAGGCGGTCAGAGATCATACAGATTACTACTGGCTCCAAAGAGCTTGACAAACTACTTCAAGGTGGAATTGAGACTGGATCTATCACAGAAATGTTTGGAGAATTCCGAACTGGGAAGACCCAGATCTGTCATACGCTAGCTGTCACCTGCCAGCTTCCCATTGACCGGGGTGGAGGTGAAGGAAAGGCCATGTACATTGACACTGAGGGTACCTTTAGGCCAGAACGGCTGCTGGCAGTGGCTGAGAGGTATGGTCTCTCTGGCAGTGATGTCCTGGATAATGTAGCATATGCTCGAGCGTTCAACACAGACCACCAGACCCAGCTCCTTTATCAAGCATCAGCCATGATGGTAGAATCTAGGTATGCACTGCTTATTGTAGACAGTGCCACCGCCCTTTACAGAACAGACTACTCGGGTCGAGGTGAGCTTTCAGCCAGGCAGATGCACTTGGCCAGGTTTCTGCGGATGCTTCTGCGACTCGCTGATGAGTTTGGTGTAGCAGTGGTAATCACTAATCAGGTGGTAGCTCAAGTGGATGGAGCAGCGATGTTTGCTGCTGATCCCAAAAAACCTATTGGAGGAAATATCATCGCCCATGCATCAACAACCAGATTGTATCTGAGGAAAGGAAGAGGGGAAACCAGAATCTGCAAAATCTACGACTCTCCCTGTCTTCCTGAAGCTGAAGCTATGTTCGCCATTAATGCAGATGGAGTGGGAGATGCCAAAGACTGA
ORF Protein Sequence MAMQMQLEANADTSVEEESFGPQPISRLEQCGINANDVKKLEEAGFHTVEAVAYAPKKELINIKGISEAKADKILAEAAKLVPMGFTTATEFHQRRSEIIQITTGSKELDKLLQGGIETGSITEMFGEFRTGKTQICHTLAVTCQLPIDRGGGEGKAMYIDTEGTFRPERLLAVAERYGLSGSDVLDNVAYARAFNTDHQTQLLYQASAMMVESRYALLIVDSATALYRTDYSGRGELSARQMHLARFLRMLLRLADEFGVAVVITNQVVAQVDGAAMFAADPKKPIGGNIIAHASTTRLYLRKGRGETRICKIYDSPCLPEAEAMFAINADGVGDAKD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T63083-Ab Anti-RAD51 monoclonal antibody
    Target Antigen GM-Tg-g-T63083-Ag RAD51 protein
    ORF Viral Vector pGMLV000274 Human RAD51 Lentivirus plasmid
    ORF Viral Vector vGMLV000274 Human RAD51 Lentivirus particle


    Target information

    Target ID GM-T63083
    Target Name RAD51
    Gene ID 5888, 19361, 708579, 499870, 101089015, 403568, 514749, 100071340
    Gene Symbol and Synonyms BRCC5,CRAD51,FANCR,HRAD51,HsRad51,HsT16930,MRMV2,RAD51,RAD51A,RECA,RGD1563603
    Uniprot Accession Q06609
    Uniprot Entry Name RAD51_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000051180
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene is a member of the RAD51 protein family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51, and are known to be involved in the homologous recombination and repair of DNA. This protein can interact with the ssDNA-binding protein RPA and RAD52, and it is thought to play roles in homologous pairing and strand transfer of DNA. This protein is also found to interact with BRCA1 and BRCA2, which may be important for the cellular response to DNA damage. BRCA2 is shown to regulate both the intracellular localization and DNA-binding ability of this protein. Loss of these controls following BRCA2 inactivation may be a key event leading to genomic instability and tumorigenesis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.