Human WNT3A ORF/cDNA clone-Lentivirus plasmid (NM_033131.3)

Cat. No.: pGMLP005569
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human WNT3A/ Lentiviral expression plasmid for WNT3A lentivirus packaging, WNT3A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to WNT3A/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $596.52
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005569
Gene Name WNT3A
Accession Number NM_033131.3
Gene ID 89780
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1059 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCCCACTCGGATACTTCTTACTCCTCTGCAGCCTGAAGCAGGCTCTGGGCAGCTACCCGATCTGGTGGTCGCTGGCTGTTGGGCCACAGTATTCCTCCCTGGGCTCGCAGCCCATCCTGTGTGCCAGCATCCCGGGCCTGGTCCCCAAGCAGCTCCGCTTCTGCAGGAACTACGTGGAGATCATGCCCAGCGTGGCCGAGGGCATCAAGATTGGCATCCAGGAGTGCCAGCACCAGTTCCGCGGCCGCCGGTGGAACTGCACCACCGTCCACGACAGCCTGGCCATCTTCGGGCCCGTGCTGGACAAAGCTACCAGGGAGTCGGCCTTTGTCCACGCCATTGCCTCAGCCGGTGTGGCCTTTGCAGTGACACGCTCATGTGCAGAAGGCACGGCCGCCATCTGTGGCTGCAGCAGCCGCCACCAGGGCTCACCAGGCAAGGGCTGGAAGTGGGGTGGCTGTAGCGAGGACATCGAGTTTGGTGGGATGGTGTCTCGGGAGTTCGCCGACGCCCGGGAGAACCGGCCAGATGCCCGCTCAGCCATGAACCGCCACAACAACGAGGCTGGGCGCCAGGCCATCGCCAGCCACATGCACCTCAAGTGCAAGTGCCACGGGCTGTCGGGCAGCTGCGAGGTGAAGACATGCTGGTGGTCGCAACCCGACTTCCGCGCCATCGGTGACTTCCTCAAGGACAAGTACGACAGCGCCTCGGAGATGGTGGTGGAGAAGCACCGGGAGTCCCGCGGCTGGGTGGAGACCCTGCGGCCGCGCTACACCTACTTCAAGGTGCCCACGGAGCGCGACCTGGTCTACTACGAGGCCTCGCCCAACTTCTGCGAGCCCAACCCTGAGACGGGCTCCTTCGGCACGCGCGACCGCACCTGCAACGTCAGCTCGCACGGCATCGACGGCTGCGACCTGCTGTGCTGCGGCCGCGGCCACAACGCGCGAGCGGAGCGGCGCCGGGAGAAGTGCCGCTGCGTGTTCCACTGGTGCTGCTACGTCAGCTGCCAGGAGTGCACGCGCGTCTACGACGTGCACACCTGCAAGTAG
ORF Protein Sequence MAPLGYFLLLCSLKQALGSYPIWWSLAVGPQYSSLGSQPILCASIPGLVPKQLRFCRNYVEIMPSVAEGIKIGIQECQHQFRGRRWNCTTVHDSLAIFGPVLDKATRESAFVHAIASAGVAFAVTRSCAEGTAAICGCSSRHQGSPGKGWKWGGCSEDIEFGGMVSREFADARENRPDARSAMNRHNNEAGRQAIASHMHLKCKCHGLSGSCEVKTCWWSQPDFRAIGDFLKDKYDSASEMVVEKHRESRGWVETLRPRYTYFKVPTERDLVYYEASPNFCEPNPETGSFGTRDRTCNVSSHGIDGCDLLCCGRGHNARAERRREKCRCVFHWCCYVSCQECTRVYDVHTCK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2573-Ab Anti-WNT3A monoclonal antibody
    Target Antigen GM-Tg-g-MP2573-Ag WNT3A VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-MP2573 wingless-type MMTV integration site family, member 3A (WNT3A) protein & antibody
    ORF Viral Vector pGMLP002017 Human WNT3A Lentivirus plasmid
    ORF Viral Vector pGMLP005569 Human WNT3A Lentivirus plasmid
    ORF Viral Vector vGMLP002017 Human WNT3A Lentivirus particle
    ORF Viral Vector vGMLP005569 Human WNT3A Lentivirus particle


    Target information

    Target ID GM-MP2573
    Target Name WNT3A
    Gene ID 89780, 22416, 696200, 303181, 101080607, 482208, 522467, 100061145
    Gene Symbol and Synonyms vt,Wnt-3a,WNT3A
    Uniprot Accession P56704
    Uniprot Entry Name WNT3A_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000154342
    Target Classification Tumor-associated antigen (TAA)

    The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 96% amino acid identity to mouse Wnt3A protein, and 84% to human WNT3 protein, another WNT gene product. This gene is clustered with WNT14 gene, another family member, in chromosome 1q42 region. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.