Human SDHB/CWS2/ IP ORF/cDNA clone-Lentivirus plasmid (NM_003000)

Pre-made Human SDHB/CWS2/ IP Lentiviral expression plasmid for SDHB lentivirus packaging, SDHB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to SDHB/CWS2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP005028 Human SDHB Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP005028
Gene Name SDHB
Accession Number NM_003000
Gene ID 6390
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 843 bp
Gene Alias CWS2, IP, PGL4, SDH, SDH1, SDH2, SDHIP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCGGCGGTGGTCGCCCTCTCCTTGAGGCGCCGGTTGCCGGCCACAACCCTTGGCGGAGCCTGCCTGCAGGCCTCCCGAGGAGCCCAGACAGCTGCAGCCACAGCTCCCCGTATCAAGAAATTTGCCATCTATCGATGGGACCCAGACAAGGCTGGAGACAAACCTCATATGCAGACTTATGAAGTTGACCTTAATAAATGTGGCCCCATGGTATTGGATGCTTTAATCAAGATTAAGAATGAAGTTGACTCTACTTTGACCTTCCGAAGATCATGCAGAGAAGGCATCTGTGGCTCTTGTGCAATGAACATCAATGGAGGCAACACTCTAGCTTGCACCCGAAGGATTGACACCAACCTCAATAAGGTCTCAAAAATCTACCCTCTTCCACACATGTATGTGATAAAGGATCTTGTTCCCGATTTGAGCAACTTCTATGCACAGTACAAATCCATTGAGCCTTATTTGAAGAAGAAGGATGAATCTCAGGAAGGCAAGCAGCAGTATCTGCAGTCCATAGAAGAGCGTGAGAAACTGGACGGGCTCTACGAGTGCATTCTCTGTGCCTGCTGTAGCACCAGCTGCCCCAGCTACTGGTGGAACGGAGACAAATATCTGGGGCCTGCAGTTCTTATGCAGGCCTATCGCTGGATGATTGACTCCAGAGATGACTTCACAGAGGAGCGCCTGGCCAAGCTGCAGGACCCATTCTCTCTATACCGCTGCCACACCATCATGAACTGCACAAGGACCTGTCCTAAGGGTCTGAATCCAGGGAAAGCTATTGCAGAGATCAAGAAAATGATGGCAACCTATAAGGAGAAGAAAGCTTCAGTTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2321-Ab Anti-SDHB/ CWS2/ IP monoclonal antibody
    Target Antigen GM-Tg-g-MP2321-Ag SDHB VLP (virus-like particle)
    ORF Viral Vector pGMLV000270 Human SDHB Lentivirus plasmid
    ORF Viral Vector pGMLP005028 Human SDHB Lentivirus plasmid
    ORF Viral Vector vGMLV000270 Human SDHB Lentivirus particle
    ORF Viral Vector vGMLP005028 Human SDHB Lentivirus particle


    Target information

    Target ID GM-MP2321
    Target Name SDHB
    Gene ID 6390, 67680, 699810, 298596, 751617, 478217, 286840, 100050091
    Gene Symbol and Synonyms 0710008N11Rik,CWS2,IP,MC2DN4,PGL4,SDH,SDH1,SDH2,SDHB,SDHIP
    Uniprot Accession P21912
    Uniprot Entry Name SDHB_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000117118
    Target Classification Tumor-associated antigen (TAA)

    This tumor suppressor gene encodes the iron-sulfur protein subunit of the succinate dehydrogenase (SDH) enzyme complex which plays a critical role in mitochondria. The SDH enzyme complex is composed of four nuclear-encoded subunits. This enzyme complex converts succinate to fumarate which releases electrons as part of the citric acid cycle, and the enzyme complex additionally provides an attachment site for released electrons to be transferred to the oxidative phosphorylation pathway. The SDH enzyme complex plays a role in oxygen-related gene regulation through its conversion of succinate, which is an oxygen sensor that stabilizes the hypoxia-inducible factor 1 (HIF1) transcription factor. Sporadic and familial mutations in this gene result in paragangliomas, pheochromocytoma, and gastrointestinal stromal tumors, supporting a link between mitochondrial dysfunction and tumorigenesis. Mutations in this gene are also implicated in nuclear type 4 mitochondrial complex II deficiency. [provided by RefSeq, Jun 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.