Human SDHB/CWS2/ IP ORF/cDNA clone-Lentivirus plasmid (NM_003000)
Pre-made Human SDHB/CWS2/ IP Lentiviral expression plasmid for SDHB lentivirus packaging, SDHB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to SDHB/CWS2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP005028 | Human SDHB Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP005028 |
Gene Name | SDHB |
Accession Number | NM_003000 |
Gene ID | 6390 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 843 bp |
Gene Alias | CWS2, IP, PGL4, SDH, SDH1, SDH2, SDHIP |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCGGCGGTGGTCGCCCTCTCCTTGAGGCGCCGGTTGCCGGCCACAACCCTTGGCGGAGCCTGCCTGCAGGCCTCCCGAGGAGCCCAGACAGCTGCAGCCACAGCTCCCCGTATCAAGAAATTTGCCATCTATCGATGGGACCCAGACAAGGCTGGAGACAAACCTCATATGCAGACTTATGAAGTTGACCTTAATAAATGTGGCCCCATGGTATTGGATGCTTTAATCAAGATTAAGAATGAAGTTGACTCTACTTTGACCTTCCGAAGATCATGCAGAGAAGGCATCTGTGGCTCTTGTGCAATGAACATCAATGGAGGCAACACTCTAGCTTGCACCCGAAGGATTGACACCAACCTCAATAAGGTCTCAAAAATCTACCCTCTTCCACACATGTATGTGATAAAGGATCTTGTTCCCGATTTGAGCAACTTCTATGCACAGTACAAATCCATTGAGCCTTATTTGAAGAAGAAGGATGAATCTCAGGAAGGCAAGCAGCAGTATCTGCAGTCCATAGAAGAGCGTGAGAAACTGGACGGGCTCTACGAGTGCATTCTCTGTGCCTGCTGTAGCACCAGCTGCCCCAGCTACTGGTGGAACGGAGACAAATATCTGGGGCCTGCAGTTCTTATGCAGGCCTATCGCTGGATGATTGACTCCAGAGATGACTTCACAGAGGAGCGCCTGGCCAAGCTGCAGGACCCATTCTCTCTATACCGCTGCCACACCATCATGAACTGCACAAGGACCTGTCCTAAGGGTCTGAATCCAGGGAAAGCTATTGCAGAGATCAAGAAAATGATGGCAACCTATAAGGAGAAGAAAGCTTCAGTTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP2321-Ab | Anti-SDHB/ CWS2/ IP monoclonal antibody |
Target Antigen | GM-Tg-g-MP2321-Ag | SDHB VLP (virus-like particle) |
ORF Viral Vector | pGMLV000270 | Human SDHB Lentivirus plasmid |
ORF Viral Vector | pGMLP005028 | Human SDHB Lentivirus plasmid |
ORF Viral Vector | vGMLV000270 | Human SDHB Lentivirus particle |
ORF Viral Vector | vGMLP005028 | Human SDHB Lentivirus particle |
Target information
Target ID | GM-MP2321 |
Target Name | SDHB |
Gene ID | 6390, 67680, 699810, 298596, 751617, 478217, 286840, 100050091 |
Gene Symbol and Synonyms | 0710008N11Rik,CWS2,IP,MC2DN4,PGL4,SDH,SDH1,SDH2,SDHB,SDHIP |
Uniprot Accession | P21912 |
Uniprot Entry Name | SDHB_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Cancer |
Gene Ensembl | ENSG00000117118 |
Target Classification | Tumor-associated antigen (TAA) |
This tumor suppressor gene encodes the iron-sulfur protein subunit of the succinate dehydrogenase (SDH) enzyme complex which plays a critical role in mitochondria. The SDH enzyme complex is composed of four nuclear-encoded subunits. This enzyme complex converts succinate to fumarate which releases electrons as part of the citric acid cycle, and the enzyme complex additionally provides an attachment site for released electrons to be transferred to the oxidative phosphorylation pathway. The SDH enzyme complex plays a role in oxygen-related gene regulation through its conversion of succinate, which is an oxygen sensor that stabilizes the hypoxia-inducible factor 1 (HIF1) transcription factor. Sporadic and familial mutations in this gene result in paragangliomas, pheochromocytoma, and gastrointestinal stromal tumors, supporting a link between mitochondrial dysfunction and tumorigenesis. Mutations in this gene are also implicated in nuclear type 4 mitochondrial complex II deficiency. [provided by RefSeq, Jun 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.