Human HDGF/HMG1L2 ORF/cDNA clone-Lentivirus plasmid (NM_001319186)

Cat. No.: pGMLP004865
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human HDGF/HMG1L2 Lentiviral expression plasmid for HDGF lentivirus packaging, HDGF lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to HDGF/HMG1L2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $498
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004865
Gene Name HDGF
Accession Number NM_001319186
Gene ID 3068
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 792 bp
Gene Alias HMG1L2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCACCCGGAAGGTGGCCAATTTGTGCCTCAACTCCTTGGCCATCTCCTGGCTACCAAACTCAAGCGTTTCCTCCTTAGCAAAGGCGGACGTAGGGCTCAAATCCCCGACGTTTCCAGGGCCACCCCCCATACGATTGACGAGATGCCTGAGGCTGCCGTGAAATCAACAGCCAACAAATACCAAGTCTTTTTTTTCGGGACCCACGAGACGGCATTCCTGGGCCCCAAAGACCTCTTCCCTTACGAGGAATCCAAGGAGAAGTTTGGCAAGCCCAACAAGAGGAAAGGGTTCAGCGAGGGGCTGTGGGAGATCGAGAACAACCCTACTGTCAAGGCTTCCGGCTATCAGCCTGTGCTGTCTCTGCTGCAGTCCTCCCAGAAAAAGAGCTGTGTGGAAGAGCCTGAACCAGAGCCCGAAGCTGCAGAGGGTGACGGTGATAAGAAGGGGAATGCAGAGGGCAGCAGCGACGAGGAAGGGAAGCTGGTCATTGATGAGCCAGCCAAGGAGAAGAACGAGAAAGGAGCGTTGAAGAGGAGAGCAGGGGACTTGCTGGAGGACTCTCCTAAACGTCCCAAGGAGGCAGAAAACCCTGAAGGAGAGGAGAAGGAGGCAGCCACCTTGGAGGTTGAGAGGCCCCTTCCTATGGAGGTGGAAAAGAATAGCACCCCCTCTGAGCCCGGCTCTGGCCGGGGGCCTCCCCAAGAGGAAGAAGAGGAGGAGGATGAAGAGGAAGAGGCTACCAAGGAAGATGCTGAGGCCCCAGGCATCAGAGATCATGAGAGCCTGTAG
ORF Protein Sequence MHPEGGQFVPQLLGHLLATKLKRFLLSKGGRRAQIPDVSRATPHTIDEMPEAAVKSTANKYQVFFFGTHETAFLGPKDLFPYEESKEKFGKPNKRKGFSEGLWEIENNPTVKASGYQPVLSLLQSSQKKSCVEEPEPEPEAAEGDGDKKGNAEGSSDEEGKLVIDEPAKEKNEKGALKRRAGDLLEDSPKRPKEAENPEGEEKEAATLEVERPLPMEVEKNSTPSEPGSGRGPPQEEEEEEDEEEEATKEDAEAPGIRDHESL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T84341-Ab Anti-HDGF/ HMG1L2 functional antibody
    Target Antigen GM-Tg-g-T84341-Ag HDGF protein
    ORF Viral Vector pGMLP004865 Human HDGF Lentivirus plasmid
    ORF Viral Vector vGMLP004865 Human HDGF Lentivirus particle


    Target information

    Target ID GM-T84341
    Target Name HDGF
    Gene ID 3068, 15191, 716742, 114499, 101082623, 100856751, 327953, 100064506
    Gene Symbol and Synonyms D3Ertd299e,HDGF,HMG1L2
    Uniprot Accession P51858
    Uniprot Entry Name HDGF_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000143321
    Target Classification Not Available

    This gene encodes a member of the hepatoma-derived growth factor family. The encoded protein has mitogenic and DNA-binding activity and may play a role in cellular proliferation and differentiation. High levels of expression of this gene enhance the growth of many tumors. This gene was thought initially to be located on chromosome X; however, that location has been determined to correspond to a related pseudogene. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jan 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.