Human CD86/B7-2/B7.2 ORF/cDNA clone-Lentivirus plasmid (NM_006889)
Cat. No.: pGMLP004743
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CD86/B7-2/B7.2 Lentiviral expression plasmid for CD86 lentivirus packaging, CD86 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
FUN1/CD86/B7-2 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP004743 |
Gene Name | CD86 |
Accession Number | NM_006889 |
Gene ID | 942 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 972 bp |
Gene Alias | B7-2,B7.2,B70,CD28LG2,LAB72 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGACTGAGTAACATTCTCTTTGTGATGGCCTTCCTGCTCTCTGGTGCTGCTCCTCTGAAGATTCAAGCTTATTTCAATGAGACTGCAGACCTGCCATGCCAATTTGCAAACTCTCAAAACCAAAGCCTGAGTGAGCTAGTAGTATTTTGGCAGGACCAGGAAAACTTGGTTCTGAATGAGGTATACTTAGGCAAAGAGAAATTTGACAGTGTTCATTCCAAGTATATGGGCCGCACAAGTTTTGATTCGGACAGTTGGACCCTGAGACTTCACAATCTTCAGATCAAGGACAAGGGCTTGTATCAATGTATCATCCATCACAAAAAGCCCACAGGAATGATTCGCATCCACCAGATGAATTCTGAACTGTCAGTGCTTGCTAACTTCAGTCAACCTGAAATAGTACCAATTTCTAATATAACAGAAAATGTGTACATAAATTTGACCTGCTCATCTATACACGGTTACCCAGAACCTAAGAAGATGAGTGTTTTGCTAAGAACCAAGAATTCAACTATCGAGTATGATGGTATTATGCAGAAATCTCAAGATAATGTCACAGAACTGTACGACGTTTCCATCAGCTTGTCTGTTTCATTCCCTGATGTTACGAGCAATATGACCATCTTCTGTATTCTGGAAACTGACAAGACGCGGCTTTTATCTTCACCTTTCTCTATAGAGCTTGAGGACCCTCAGCCTCCCCCAGACCACATTCCTTGGATTACAGCTGTACTTCCAACAGTTATTATATGTGTGATGGTTTTCTGTCTAATTCTATGGAAATGGAAGAAGAAGAAGCGGCCTCGCAACTCTTATAAATGTGGAACCAACACAATGGAGAGGGAAGAGAGTGAACAGACCAAGAAAAGAGAAAAAATCCATATACCTGAAAGATCTGATGAAGCCCAGCGTGTTTTTAAAAGTTCGAAGACATCTTCATGCGACAAAAGTGATACATGTTTTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T50912-Ab | Anti-CD86/ FUN1/ B7-2 monoclonal antibody |
Target Antigen | GM-Tg-g-T50912-Ag | FUN1/CD86 VLP (virus-like particle) |
ORF Viral Vector | pGMLP004743 | Human CD86 Lentivirus plasmid |
ORF Viral Vector | vGMLP004743 | Human CD86 Lentivirus particle |
Target information
Target ID | GM-T50912 |
Target Name | FUN1 |
Gene ID | 942, 12524, 714390, 56822, 493704, 403764, 414345, 100060767 |
Gene Symbol and Synonyms | B7,B7-2,B7.2,B70,Cd28l2,CD28LG2,CD86,CLS1,ETC-1,LAB72,Ly-58,Ly58,MB7,MB7-2,TS/A-2 |
Uniprot Accession | P42081 |
Uniprot Entry Name | CD86_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000114013 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a type I membrane protein that is a member of the immunoglobulin superfamily. This protein is expressed by antigen-presenting cells, and it is the ligand for two proteins at the cell surface of T cells, CD28 antigen and cytotoxic T-lymphocyte-associated protein 4. Binding of this protein with CD28 antigen is a costimulatory signal for activation of the T-cell. Binding of this protein with cytotoxic T-lymphocyte-associated protein 4 negatively regulates T-cell activation and diminishes the immune response. Alternative splicing results in several transcript variants encoding different isoforms.[provided by RefSeq, May 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.