Human KID/AQP2L/KID ORF/cDNA clone-Lentivirus plasmid (NM_001652)
Cat. No.: pGMLP004738
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human KID/AQP2L/KID Lentiviral expression plasmid for KID lentivirus packaging, KID lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
AQP6/KID/AQP2L products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP004738 |
Gene Name | KID |
Accession Number | NM_001652 |
Gene ID | 363 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 849 bp |
Gene Alias | AQP2L,KID |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGATGCAGTGGAGCCAGGGGGACGTGGCTGGGCCAGCATGTTGGCGTGCAGGCTTTGGAAAGCCATCAGCAGGGCGCTGTTTGCAGAGTTCCTGGCCACGGGGCTGTATGTGTTCTTTGGCGTGGGCTCAGTCATGCGCTGGCCCACAGCACTTCCCTCCGTGCTACAGATTGCCATCACCTTCAACCTGGTCACCGCCATGGCTGTGCAGGTCACCTGGAAGGCCAGCGGGGCCCACGCCAACCCCGCCGTGACGCTGGCCTTCCTCGTAGGCTCCCACATCTCTCTGCCCCGTGCTGTGGCCTATGTGGCTGCCCAGCTGGTGGGGGCCACGGTGGGGGCTGCTCTGCTTTATGGGGTCATGCCGGGAGACATCCGAGAGACCCTTGGGATCAACGTGGTCCGGAACAGTGTCTCAACTGGCCAGGCGGTGGCAGTGGAGCTGCTTCTGACCCTGCAGCTGGTGCTCTGTGTCTTCGCTTCCACCGACAGCCGTCAGACATCAGGCTCCCCGGCCACCATGATTGGGATCTCTGTGGCACTGGGCCACCTCATTGGGATCCACTTCACTGGCTGCTCCATGAATCCAGCCCGCTCCTTCGGCCCTGCCATCATCATTGGGAAGTTCACAGTCCACTGGGTCTTCTGGGTGGGGCCCCTGATGGGAGCCCTCCTGGCCTCACTGATCTACAACTTCGTCCTGTTCCCCGACACCAAGACCCTGGCGCAGCGGCTGGCTATCCTCACAGGCACCGTAGAGGTGGGGACAGGGGCAGGGGCAGGGGCGGAGCCCCTGAAGAAGGAATCCCAGCCGGGTTCGGGAGCCGTGGAGATGGAGAGTGTGTGA |
ORF Protein Sequence | MDAVEPGGRGWASMLACRLWKAISRALFAEFLATGLYVFFGVGSVMRWPTALPSVLQIAITFNLVTAMAVQVTWKASGAHANPAVTLAFLVGSHISLPRAVAYVAAQLVGATVGAALLYGVMPGDIRETLGINVVRNSVSTGQAVAVELLLTLQLVLCVFASTDSRQTSGSPATMIGISVALGHLIGIHFTGCSMNPARSFGPAIIIGKFTVHWVFWVGPLMGALLASLIYNFVLFPDTKTLAQRLAILTGTVEVGTGAGAGAEPLKKESQPGSGAVEMESV |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0082-Ab | Anti-AQP6/ AQP2L/ KID monoclonal antibody |
Target Antigen | GM-Tg-g-MP0082-Ag | AQP6 VLP (virus-like particle) |
ORF Viral Vector | pGMLP004738 | Human KID Lentivirus plasmid |
ORF Viral Vector | vGMLP004738 | Human KID Lentivirus particle |
Target information
Target ID | GM-MP0082 |
Target Name | AQP6 |
Gene ID | 363, 11831, 711968, 29170, 101093446, 607978, 527759, 100629869 |
Gene Symbol and Synonyms | AQP2L,AQP6,KID |
Uniprot Accession | Q13520 |
Uniprot Entry Name | AQP6_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000086159 |
Target Classification | Not Available |
The protein encoded by this gene is an aquaporin protein, which functions as a water channel in cells. Aquaporins are a family of small integral membrane proteins related to the major intrinsic protein (MIP or AQP0). This protein is specific for the kidney. This gene and related family members AQP0, AQP2, and AQP5 reside in a cluster on chromosome 12q13. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.