Human KID/AQP2L/KID ORF/cDNA clone-Lentivirus plasmid (NM_001652)

Cat. No.: pGMLP004738
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human KID/AQP2L/KID Lentiviral expression plasmid for KID lentivirus packaging, KID lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to AQP6/KID/AQP2L products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $512.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004738
Gene Name KID
Accession Number NM_001652
Gene ID 363
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 849 bp
Gene Alias AQP2L,KID
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGATGCAGTGGAGCCAGGGGGACGTGGCTGGGCCAGCATGTTGGCGTGCAGGCTTTGGAAAGCCATCAGCAGGGCGCTGTTTGCAGAGTTCCTGGCCACGGGGCTGTATGTGTTCTTTGGCGTGGGCTCAGTCATGCGCTGGCCCACAGCACTTCCCTCCGTGCTACAGATTGCCATCACCTTCAACCTGGTCACCGCCATGGCTGTGCAGGTCACCTGGAAGGCCAGCGGGGCCCACGCCAACCCCGCCGTGACGCTGGCCTTCCTCGTAGGCTCCCACATCTCTCTGCCCCGTGCTGTGGCCTATGTGGCTGCCCAGCTGGTGGGGGCCACGGTGGGGGCTGCTCTGCTTTATGGGGTCATGCCGGGAGACATCCGAGAGACCCTTGGGATCAACGTGGTCCGGAACAGTGTCTCAACTGGCCAGGCGGTGGCAGTGGAGCTGCTTCTGACCCTGCAGCTGGTGCTCTGTGTCTTCGCTTCCACCGACAGCCGTCAGACATCAGGCTCCCCGGCCACCATGATTGGGATCTCTGTGGCACTGGGCCACCTCATTGGGATCCACTTCACTGGCTGCTCCATGAATCCAGCCCGCTCCTTCGGCCCTGCCATCATCATTGGGAAGTTCACAGTCCACTGGGTCTTCTGGGTGGGGCCCCTGATGGGAGCCCTCCTGGCCTCACTGATCTACAACTTCGTCCTGTTCCCCGACACCAAGACCCTGGCGCAGCGGCTGGCTATCCTCACAGGCACCGTAGAGGTGGGGACAGGGGCAGGGGCAGGGGCGGAGCCCCTGAAGAAGGAATCCCAGCCGGGTTCGGGAGCCGTGGAGATGGAGAGTGTGTGA
ORF Protein Sequence MDAVEPGGRGWASMLACRLWKAISRALFAEFLATGLYVFFGVGSVMRWPTALPSVLQIAITFNLVTAMAVQVTWKASGAHANPAVTLAFLVGSHISLPRAVAYVAAQLVGATVGAALLYGVMPGDIRETLGINVVRNSVSTGQAVAVELLLTLQLVLCVFASTDSRQTSGSPATMIGISVALGHLIGIHFTGCSMNPARSFGPAIIIGKFTVHWVFWVGPLMGALLASLIYNFVLFPDTKTLAQRLAILTGTVEVGTGAGAGAEPLKKESQPGSGAVEMESV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0082-Ab Anti-AQP6/ AQP2L/ KID monoclonal antibody
    Target Antigen GM-Tg-g-MP0082-Ag AQP6 VLP (virus-like particle)
    ORF Viral Vector pGMLP004738 Human KID Lentivirus plasmid
    ORF Viral Vector vGMLP004738 Human KID Lentivirus particle


    Target information

    Target ID GM-MP0082
    Target Name AQP6
    Gene ID 363, 11831, 711968, 29170, 101093446, 607978, 527759, 100629869
    Gene Symbol and Synonyms AQP2L,AQP6,KID
    Uniprot Accession Q13520
    Uniprot Entry Name AQP6_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000086159
    Target Classification Not Available

    The protein encoded by this gene is an aquaporin protein, which functions as a water channel in cells. Aquaporins are a family of small integral membrane proteins related to the major intrinsic protein (MIP or AQP0). This protein is specific for the kidney. This gene and related family members AQP0, AQP2, and AQP5 reside in a cluster on chromosome 12q13. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.