Human LGALS7/GAL7/ LGALS7A ORF/cDNA clone-Lentivirus plasmid (NM_002307)

Pre-made Human LGALS7/GAL7/ LGALS7A Lentiviral expression plasmid for LGALS7 lentivirus packaging, LGALS7 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to LGALS7/GAL7 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004553 Human LGALS7 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004553
Gene Name LGALS7
Accession Number NM_002307
Gene ID 3963
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 411 bp
Gene Alias GAL7, LGALS7A
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTCCAACGTCCCCCACAAGTCCTCACTGCCCGAGGGCATCCGCCCTGGCACGGTGCTGAGAATTCGCGGCTTGGTTCCTCCCAATGCCAGCAGGTTCCATGTAAACCTGCTGTGCGGGGAGGAGCAGGGCTCCGATGCCGCGCTGCATTTCAACCCCCGGCTGGACACGTCGGAGGTGGTCTTCAACAGCAAGGAGCAAGGCTCCTGGGGCCGCGAGGAGCGCGGGCCGGGCGTTCCTTTCCAGCGCGGGCAGCCCTTCGAGGTGCTCATCATCGCGTCAGACGACGGCTTCAAGGCCGTGGTTGGGGACGCCCAGTACCACCACTTCCGCCACCGCCTGCCGCTGGCGCGCGTGCGCCTGGTGGAGGTGGGCGGGGACGTGCAGCTGGACTCCGTGAGGATCTTCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1656-Ab Anti-LEG7/ LGALS7/ GAL7A functional antibody
    Target Antigen GM-Tg-g-SE1656-Ag LGALS7 protein
    ORF Viral Vector pGMLP004553 Human LGALS7 Lentivirus plasmid
    ORF Viral Vector vGMLP004553 Human LGALS7 Lentivirus particle


    Target information

    Target ID GM-SE1656
    Target Name LGALS7
    Gene ID 3963, 16858, 29518, 787811
    Gene Symbol and Synonyms GAL7,Galectin-7,LGALS7,LGALS7A,Pig1
    Uniprot Accession P47929
    Uniprot Entry Name LEG7_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000205076
    Target Classification Not Available

    The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. Differential and in situ hybridization studies indicate that this lectin is specifically expressed in keratinocytes and found mainly in stratified squamous epithelium. A duplicate copy of this gene (GeneID:653499) is found adjacent to, but on the opposite strand on chromosome 19. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.