Human LGALS7/GAL7/ LGALS7A ORF/cDNA clone-Lentivirus plasmid (NM_002307)
Pre-made Human LGALS7/GAL7/ LGALS7A Lentiviral expression plasmid for LGALS7 lentivirus packaging, LGALS7 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to LGALS7/GAL7 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP004553 | Human LGALS7 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP004553 |
Gene Name | LGALS7 |
Accession Number | NM_002307 |
Gene ID | 3963 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 411 bp |
Gene Alias | GAL7, LGALS7A |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTCCAACGTCCCCCACAAGTCCTCACTGCCCGAGGGCATCCGCCCTGGCACGGTGCTGAGAATTCGCGGCTTGGTTCCTCCCAATGCCAGCAGGTTCCATGTAAACCTGCTGTGCGGGGAGGAGCAGGGCTCCGATGCCGCGCTGCATTTCAACCCCCGGCTGGACACGTCGGAGGTGGTCTTCAACAGCAAGGAGCAAGGCTCCTGGGGCCGCGAGGAGCGCGGGCCGGGCGTTCCTTTCCAGCGCGGGCAGCCCTTCGAGGTGCTCATCATCGCGTCAGACGACGGCTTCAAGGCCGTGGTTGGGGACGCCCAGTACCACCACTTCCGCCACCGCCTGCCGCTGGCGCGCGTGCGCCTGGTGGAGGTGGGCGGGGACGTGCAGCTGGACTCCGTGAGGATCTTCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1656-Ab | Anti-LEG7/ LGALS7/ GAL7A functional antibody |
Target Antigen | GM-Tg-g-SE1656-Ag | LGALS7 protein |
ORF Viral Vector | pGMLP004553 | Human LGALS7 Lentivirus plasmid |
ORF Viral Vector | vGMLP004553 | Human LGALS7 Lentivirus particle |
Target information
Target ID | GM-SE1656 |
Target Name | LGALS7 |
Gene ID | 3963, 16858, 29518, 787811 |
Gene Symbol and Synonyms | GAL7,Galectin-7,LGALS7,LGALS7A,Pig1 |
Uniprot Accession | P47929 |
Uniprot Entry Name | LEG7_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000205076 |
Target Classification | Not Available |
The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. Differential and in situ hybridization studies indicate that this lectin is specifically expressed in keratinocytes and found mainly in stratified squamous epithelium. A duplicate copy of this gene (GeneID:653499) is found adjacent to, but on the opposite strand on chromosome 19. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.