Human CTLA4/ALPS5/ CD ORF/cDNA clone-Lentivirus plasmid (NM_005214)

Pre-made Human CTLA4/ALPS5/ CD Lentiviral expression plasmid for CTLA4 lentivirus packaging, CTLA4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CTLA-4/CTLA4/ALPS5 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004479 Human CTLA4 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004479
Gene Name CTLA4
Accession Number NM_005214
Gene ID 1493
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 672 bp
Gene Alias ALPS5, CD, CD152, CELIAC3, CTLA-4, GRD4, GSE, IDDM12
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCTTGCCTTGGATTTCAGCGGCACAAGGCTCAGCTGAACCTGGCTACCAGGACCTGGCCCTGCACTCTCCTGTTTTTTCTTCTCTTCATCCCTGTCTTCTGCAAAGCAATGCACGTGGCCCAGCCTGCTGTGGTACTGGCCAGCAGCCGAGGCATCGCCAGCTTTGTGTGTGAGTATGCATCTCCAGGCAAAGCCACTGAGGTCCGGGTGACAGTGCTTCGGCAGGCTGACAGCCAGGTGACTGAAGTCTGTGCGGCAACCTACATGATGGGGAATGAGTTGACCTTCCTAGATGATTCCATCTGCACGGGCACCTCCAGTGGAAATCAAGTGAACCTCACTATCCAAGGACTGAGGGCCATGGACACGGGACTCTACATCTGCAAGGTGGAGCTCATGTACCCACCGCCATACTACCTGGGCATAGGCAACGGAACCCAGATTTATGTAATTGATCCAGAACCGTGCCCAGATTCTGACTTCCTCCTCTGGATCCTTGCAGCAGTTAGTTCGGGGTTGTTTTTTTATAGCTTTCTCCTCACAGCTGTTTCTTTGAGCAAAATGCTAAAGAAAAGAAGCCCTCTTACAACAGGGGTCTATGTGAAAATGCCCCCAACAGAGCCAGAATGTGAAAAGCAATTTCAGCCTTATTTTATTCCCATCAATTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-088 Pre-Made Cadonilimab biosimilar, Bispecific Mixed mAb and scFv, Anti-PDCD1/PD-1;CTLA4/CTLA-4 antibody: Anti-CD279/PD1/SLEB2/hPD-1/hPD-l/hSLE1;CD/GSE/GRD4/ALPS5/CD152/IDDM12/CELIAC3 therapeutic antibody
    Biosimilar GMP-Bios-ab-679 Pre-Made Lorigerlimab biosimilar, Whole mAb, Anti-PDCD1/PD-1;CTLA4/CTLA-4 Antibody: Anti-CD279/PD1/SLEB2/hPD-1/hPD-l/hSLE1;CD/GSE/GRD4/ALPS5/CD152/IDDM12/CELIAC3 therapeutic antibody
    Biosimilar GMP-Bios-ab-460 Pre-Made Quavonlimab biosimilar, Whole mAb, Anti-CTLA4/CTLA-4 Antibody: Anti-CD/GSE/GRD4/ALPS5/CD152/IDDM12/CELIAC3 therapeutic antibody
    Biosimilar GMP-Bios-ab-382 Pre-Made Nurulimab biosimilar, Whole mAb, Anti-CTLA4/CTLA-4 Antibody: Anti-CD/GSE/GRD4/ALPS5/CD152/IDDM12/CELIAC3 therapeutic antibody
    Biosimilar GMP-Bios-ab-078 Pre-Made Botensilimab biosimilar, Whole mAb, Anti-CTLA4/CTLA-4 Antibody: Anti-CD/GSE/GRD4/ALPS5/CD152/IDDM12/CELIAC3 therapeutic antibody
    Biosimilar GMP-Bios-ab-704 Pre-Made Tuvonralimab biosimilar, Whole mAb, Anti-CTLA4/CTLA-4 Antibody: Anti-CD/GSE/GRD4/ALPS5/CD152/IDDM12/CELIAC3 therapeutic antibody
    Biosimilar GMP-Bios-INN-712 Pre-Made Abatacept Biosimilar, Fusion Protein targeting CTLA4/CTLA-4 fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting CD/GSE/GRD4/ALPS5/CD152/IDDM12/CELIAC3
    Biosimilar GMP-Bios-ab-631 Pre-Made Vudalimab biosimilar, Bispecific Mixed mAb and scFv, Anti-CTLA4/CTLA-4;PDCD1/PD-1 Antibody: Anti-CD/GSE/GRD4/ALPS5/CD152/IDDM12/CELIAC3;CD279/SLEB2/hPD-1/hPD-l/hSLE1 therapeutic antibody
    Biosimilar GMP-Bios-ab-277 Pre-Made Ipilimumab biosimilar, Whole mAb, Anti-CTLA4/CTLA-4 Antibody: Anti-CD/GSE/GRD4/ALPS5/CD152/IDDM12/CELIAC3 therapeutic antibody
    Biosimilar GMP-Bios-ab-194 Pre-Made Erfonrilimab biosimilar, Bispecific Single Domains (VH-VH'-CH), Anti-CD274/PD-L1;CTLA4/CTLA-4 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1;CD/GSE/GRD4/ALPS5/CD152/IDDM12/CELIAC3 therapeutic antibody
    Biosimilar GMP-Bios-ab-569 Pre-Made Ticilimumab biosimilar, Whole mAb, Anti-CTLA4/CTLA-4 Antibody: Anti-CD/GSE/GRD4/ALPS5/CD152/IDDM12/CELIAC3 therapeutic antibody
    Biosimilar GMP-Bios-ab-636 Pre-Made Zalifrelimab biosimilar, Whole mAb, Anti-CTLA4/CTLA-4 Antibody: Anti-CD/GSE/GRD4/ALPS5/CD152/IDDM12/CELIAC3 therapeutic antibody
    Biosimilar GMP-Bios-ab-432 Pre-Made Pavunalimab biosimilar, Bispecific Mixed mAb and scFv, Anti-LAG3;CTLA4/CTLA-4 Antibody: Anti-CD223;CD/GSE/GRD4/ALPS5/CD152/IDDM12/CELIAC3 therapeutic antibody
    Biosimilar GMP-Bios-ab-595 Pre-Made Tremelimumab biosimilar, Whole mAb, Anti-CTLA4/CTLA-4 Antibody: Anti-CD/GSE/GRD4/ALPS5/CD152/IDDM12/CELIAC3 therapeutic antibody
    Target Antibody GM-Tg-g-T15000-Ab Anti-CTLA4/ CTLA-4/ ALPS5 monoclonal antibody
    Target Antigen GM-Tg-g-T15000-Ag CTLA-4/CTLA4 VLP (virus-like particle)
    ORF Viral Vector pGMLP004479 Human CTLA4 Lentivirus plasmid
    ORF Viral Vector vGMLP004479 Human CTLA4 Lentivirus particle


    Target information

    Target ID GM-T15000
    Target Name CTLA-4
    Gene ID 1493, 12477, 705673, 63835, 493743, 403696, 281732, 100067931
    Gene Symbol and Synonyms ALPS5,CD,CD152,CELIAC3,CTLA-4,CTLA4,GRD4,GSE,IDDM12,Ly-56,sCTLA4
    Uniprot Accession P16410
    Uniprot Entry Name CTLA4_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Hepatitis - type 1 autoimmune, Grave's Disease, Autoimmune thyroid diseases, asthma
    Gene Ensembl ENSG00000163599
    Target Classification Checkpoint-Immuno Oncology

    This gene is a member of the immunoglobulin superfamily and encodes a protein which transmits an inhibitory signal to T cells. The protein contains a V domain, a transmembrane domain, and a cytoplasmic tail. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. The membrane-bound isoform functions as a homodimer interconnected by a disulfide bond, while the soluble isoform functions as a monomer. Mutations in this gene have been associated with insulin-dependent diabetes mellitus, Graves disease, Hashimoto thyroiditis, celiac disease, systemic lupus erythematosus, thyroid-associated orbitopathy, and other autoimmune diseases. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.