Human CALN1/CABP8 ORF/cDNA clone-Lentivirus plasmid (NM_031468)

Cat. No.: pGMLP004455
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CALN1/CABP8 Lentiviral expression plasmid for CALN1 lentivirus packaging, CALN1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CALN1/CABP8 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $496.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004455
Gene Name CALN1
Accession Number NM_031468
Gene ID 83698
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 786 bp
Gene Alias CABP8
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCGGCTGCCAGAGCAACCCGGAGAGGGGAAGCCCGAGAATGAGAAAAAGGGGGACGGAGGAGCCCTCGGAGGGGGAGAGGAGCCGCCGAGGAGCCAGGCCCCCGACTTCCCCACCTGGGAAAAGATGCCGTTCCACCATGTGACCGCCGGCTTGTTGTACAAGGGGAATTACCTCAACCGATCGCTCTCTGCTGGCAGTGACAGCGAACAGCTGGCTAATATCTCCGTGGAGGAGCTCGATGAAATCCGAGAGGCCTTTCGGGTTCTGGACCGGGATGGGAACGGCTTCATCTCCAAGCAGGAGCTGGGCATGGCCATGCGCTCTTTGGGGTACATGCCAAGCGAGGTGGAGCTGGCCATCATCATGCAGCGCTTGGACATGGACGGGGATGGCCAGGTGGATTTTGATGAATTCATGACCATTCTTGGCCCCAAACTGGTGTCTTCAGAAGGTCGCGATGGTTTTCTTGGGAACACGATAGACAGCATATTCTGGCAGTTTGACATGCAAAGGATAACTCTGGAAGAGTTGAAGCACATTCTCTATCATGCCTTCCGAGACCACCTAACGATGAAGGACATTGAGAACATCATTATCAATGAGGAAGAGAGCCTGAATGAGACCTCGGGGAACTGCCAAACAGAGTTTGAAGGAGTGCATTCCCAGAAGCAGAACAGACAGACCTGCGTCCGGAAGAGCCTCATATGCGCCTTTGCTATGGCCTTCATCATCAGTGTCATGCTGATTGCAGCCAACCAGATACTCCGGAGCGGCATGGAGTAG
ORF Protein Sequence MRLPEQPGEGKPENEKKGDGGALGGGEEPPRSQAPDFPTWEKMPFHHVTAGLLYKGNYLNRSLSAGSDSEQLANISVEELDEIREAFRVLDRDGNGFISKQELGMAMRSLGYMPSEVELAIIMQRLDMDGDGQVDFDEFMTILGPKLVSSEGRDGFLGNTIDSIFWQFDMQRITLEELKHILYHAFRDHLTMKDIENIIINEEESLNETSGNCQTEFEGVHSQKQNRQTCVRKSLICAFAMAFIISVMLIAANQILRSGME

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0177-Ab Anti-CABP8/ CALN1 monoclonal antibody
    Target Antigen GM-Tg-g-MP0177-Ag CALN1 VLP (virus-like particle)
    ORF Viral Vector pGMLP004455 Human CALN1 Lentivirus plasmid
    ORF Viral Vector vGMLP004455 Human CALN1 Lentivirus particle


    Target information

    Target ID GM-MP0177
    Target Name CALN1
    Gene ID 83698, 140904, 695315, 363909, 101100355, 607123, 538163, 100062180
    Gene Symbol and Synonyms 9630012C17Rik,CABP8,CALN1,MNCb-0849
    Uniprot Accession Q9BXU9
    Uniprot Entry Name CABP8_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000183166
    Target Classification Not Available

    This gene encodes a protein with high similarity to the calcium-binding proteins of the calmodulin family. The encoded protein contains two EF-hand domains and potential calcium-binding sites. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.