Human NRG4/HRG4 ORF/cDNA clone-Lentivirus plasmid (NM_138573)
Pre-made Human NRG4/HRG4 Lentiviral expression plasmid for NRG4 lentivirus packaging, NRG4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to NRG4/HRG4 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP004430 | Human NRG4 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP004430 |
Gene Name | NRG4 |
Accession Number | NM_138573 |
Gene ID | 145957 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 348 bp |
Gene Alias | HRG4 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCCAACAGATCACGAAGAGCCCTGTGGTCCCAGTCACAAGTCGTTTTGCCTGAATGGGGGGCTTTGTTATGTGATACCTACTATTCCCAGCCCATTTTGTAGGTGCGTTGAAAACTATACAGGAGCTCGTTGTGAAGAGGTTTTTCTCCCAGGCTCCAGCATCCAAACTAAAAGTAACCTGTTTGAAGCTTTTGTGGCATTGGCGGTCCTAGTAACACTTATCATTGGAGCCTTCTACTTCCTTTGCAGGAAAGGCCACTTTCAGAGAGCCAGTTCAGTCCAGTATGATATCAACCTGGTAGAGACGAGCAGTACCAGTGCCCACCACAGTCATGAACAACACTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T97314-Ab | Anti-NRG4/ HRG4 monoclonal antibody |
Target Antigen | GM-Tg-g-T97314-Ag | NRG4 VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-T97314 | neuregulin 4 (NRG4) protein & antibody |
ORF Viral Vector | pGMLP004430 | Human NRG4 Lentivirus plasmid |
ORF Viral Vector | vGMLP004430 | Human NRG4 Lentivirus particle |
Target information
Target ID | GM-T97314 |
Target Name | NRG4 |
Gene ID | 145957, 83961, 707378, 690919, 101095102, 111093125, 100630158 |
Gene Symbol and Synonyms | HRG4,NRG4 |
Uniprot Accession | Q8WWG1 |
Uniprot Entry Name | NRG4_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000169752 |
Target Classification | Not Available |
The neuregulins, including NRG4, activate type-1 growth factor receptors (see EGFR; MIM 131550) to initiating cell-to-cell signaling through tyrosine phosphorylation (Harari et al., 1999 [PubMed 10348342]).[supplied by OMIM, Mar 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.