Human NRG4/HRG4 ORF/cDNA clone-Lentivirus plasmid (NM_138573)

Pre-made Human NRG4/HRG4 Lentiviral expression plasmid for NRG4 lentivirus packaging, NRG4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to NRG4/HRG4 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004430 Human NRG4 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004430
Gene Name NRG4
Accession Number NM_138573
Gene ID 145957
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 348 bp
Gene Alias HRG4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCCAACAGATCACGAAGAGCCCTGTGGTCCCAGTCACAAGTCGTTTTGCCTGAATGGGGGGCTTTGTTATGTGATACCTACTATTCCCAGCCCATTTTGTAGGTGCGTTGAAAACTATACAGGAGCTCGTTGTGAAGAGGTTTTTCTCCCAGGCTCCAGCATCCAAACTAAAAGTAACCTGTTTGAAGCTTTTGTGGCATTGGCGGTCCTAGTAACACTTATCATTGGAGCCTTCTACTTCCTTTGCAGGAAAGGCCACTTTCAGAGAGCCAGTTCAGTCCAGTATGATATCAACCTGGTAGAGACGAGCAGTACCAGTGCCCACCACAGTCATGAACAACACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T97314-Ab Anti-NRG4/ HRG4 monoclonal antibody
    Target Antigen GM-Tg-g-T97314-Ag NRG4 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T97314 neuregulin 4 (NRG4) protein & antibody
    ORF Viral Vector pGMLP004430 Human NRG4 Lentivirus plasmid
    ORF Viral Vector vGMLP004430 Human NRG4 Lentivirus particle


    Target information

    Target ID GM-T97314
    Target Name NRG4
    Gene ID 145957, 83961, 707378, 690919, 101095102, 111093125, 100630158
    Gene Symbol and Synonyms HRG4,NRG4
    Uniprot Accession Q8WWG1
    Uniprot Entry Name NRG4_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000169752
    Target Classification Not Available

    The neuregulins, including NRG4, activate type-1 growth factor receptors (see EGFR; MIM 131550) to initiating cell-to-cell signaling through tyrosine phosphorylation (Harari et al., 1999 [PubMed 10348342]).[supplied by OMIM, Mar 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.