Human CD300C/CLM-6/CMRF-35 ORF/cDNA clone-Lentivirus plasmid (NM_006678)

Cat. No.: pGMLP004397
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CD300C/CLM-6/CMRF-35 Lentiviral expression plasmid for CD300C lentivirus packaging, CD300C lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CD300C/CLM-6 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $468.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004397
Gene Name CD300C
Accession Number NM_006678
Gene ID 10871
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 675 bp
Gene Alias CLM-6,CMRF-35,CMRF-35A,CMRF35,CMRF35-A1,CMRF35A,CMRF35A1,IGSF16,LIR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACTGCCAGGGCCTGGGCCTCGTGGCGGTCTTCAGCTCTGCTCCTCCTGCTTGTCCCAGGCTATTTTCCTCTGAGCCACCCCATGACCGTGGCGGGCCCCGTGGGGGGATCCCTGAGTGTGCAGTGTCGCTATGAGAAGGAACACAGGACCCTCAACAAATTCTGGTGCAGACCACCACAGATTCTCCGATGTGACAAGATTGTGGAGACCAAAGGGTCAGCAGGGAAAAGGAATGGCCGAGTGTCCATCAGGGACAGTCCTGCAAACCTCAGCTTCACAGTGACCCTGGAGAATCTCACAGAGGAGGACGCAGGCACCTACTGGTGTGGGGTGGATACACCGTGGCTCCGAGACTTTCATGATCCCATTGTCGAGGTTGAGGTGTCCGTGTTCCCGGCCGGGACGACCACAGCCTCCAGCCCCCAGAGCTCCATGGGCACCTCAGGTCCTCCCACGAAGCTGCCCGTGCACACCTGGCCCAGCGTGACCAGAAAGGACAGCCCCGAACCCAGCCCACACCCTGGCTCCCTGTTCAGCAATGTCCGCTTCCTGCTCCTGGTCCTCTTGGAGCTGCCCCTGCTCCTGAGCATGCTGGGTGCCGTCCTCTGGGTGAACAGACCTCAGAGAAGCTCTAGAAGCAGGCAGAATTGGCCCAAGGGTGAGAACCAGTAG
ORF Protein Sequence MTARAWASWRSSALLLLLVPGYFPLSHPMTVAGPVGGSLSVQCRYEKEHRTLNKFWCRPPQILRCDKIVETKGSAGKRNGRVSIRDSPANLSFTVTLENLTEEDAGTYWCGVDTPWLRDFHDPIVEVEVSVFPAGTTTASSPQSSMGTSGPPTKLPVHTWPSVTRKDSPEPSPHPGSLFSNVRFLLLVLLELPLLLSMLGAVLWVNRPQRSSRSRQNWPKGENQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0205-Ab Anti-CLM6/ CD300C/ CLM-6 monoclonal antibody
    Target Antigen GM-Tg-g-MP0205-Ag CD300C VLP (virus-like particle)
    ORF Viral Vector pGMLP004397 Human CD300C Lentivirus plasmid
    ORF Viral Vector vGMLP004397 Human CD300C Lentivirus particle


    Target information

    Target ID GM-MP0205
    Target Name CD300C
    Gene ID 10871, 387565, 697839
    Gene Symbol and Synonyms CD300C,CLM-6,Clm6,CMRF-35,CMRF-35A,CMRF35,CMRF35-A1,CMRF35A,CMRF35A1,IGSF16,LIR
    Uniprot Accession Q08708
    Uniprot Entry Name CLM6_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000167850
    Target Classification Not Available

    The CMRF35 antigen, which was identified by reactivity with a monoclonal antibody, is present on monocytes, neutrophils, and some T and B lymphocytes (Jackson et al., 1992 [PubMed 1349532]).[supplied by OMIM, Mar 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.