Human WNT5B ORF/cDNA clone-Lentivirus plasmid (NM_030775)

Cat. No.: pGMLP004360
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human WNT5B/ Lentiviral expression plasmid for WNT5B lentivirus packaging, WNT5B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to WNT5B/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $602.4
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004360
Gene Name WNT5B
Accession Number NM_030775
Gene ID 81029
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1080 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCCCAGCCTGCTGCTGCTGTTCACGGCTGCTCTGCTGTCCAGCTGGGCTCAGCTTCTGACAGACGCCAACTCCTGGTGGTCATTAGCTTTGAACCCGGTGCAGAGACCCGAGATGTTTATCATCGGTGCCCAGCCCGTGTGCAGTCAGCTTCCCGGGCTCTCCCCTGGCCAGAGGAAGCTGTGCCAATTGTACCAGGAGCACATGGCCTACATAGGGGAGGGAGCCAAGACTGGCATCAAGGAATGCCAGCACCAGTTCCGGCAGCGGCGGTGGAATTGCAGCACAGCGGACAACGCATCTGTCTTTGGGAGAGTCATGCAGATAGGCAGCCGAGAGACCGCCTTCACCCACGCGGTGAGCGCCGCGGGCGTGGTCAACGCCATCAGCCGGGCCTGCCGCGAGGGCGAGCTCTCCACCTGCGGCTGCAGCCGGACGGCGCGGCCCAAGGACCTGCCCCGGGACTGGCTGTGGGGCGGCTGTGGGGACAACGTGGAGTACGGCTACCGCTTCGCCAAGGAGTTTGTGGATGCCCGGGAGCGAGAGAAGAACTTTGCCAAAGGATCAGAGGAGCAGGGCCGGGTGCTCATGAACCTGCAAAACAACGAGGCCGGTCGCAGGGCTGTGTATAAGATGGCAGACGTAGCCTGCAAATGCCACGGCGTCTCGGGGTCCTGCAGCCTCAAGACCTGCTGGCTGCAGCTGGCCGAGTTCCGCAAGGTCGGGGACCGGCTGAAGGAGAAGTACGACAGCGCGGCCGCCATGCGCGTCACCCGCAAGGGCCGGCTGGAGCTGGTCAACAGCCGCTTCACCCAGCCCACCCCGGAGGACCTGGTCTATGTGGACCCCAGCCCCGACTACTGCCTGCGCAACGAGAGCACGGGCTCCCTGGGCACGCAGGGCCGCCTCTGCAACAAGACCTCGGAGGGCATGGATGGCTGTGAGCTCATGTGCTGCGGGCGTGGCTACAACCAGTTCAAGAGCGTGCAGGTGGAGCGCTGCCACTGCAAGTTCCACTGGTGCTGCTTCGTCAGGTGTAAGAAGTGCACGGAGATCGTGGACCAGTACATCTGTAAATAG
ORF Protein Sequence MPSLLLLFTAALLSSWAQLLTDANSWWSLALNPVQRPEMFIIGAQPVCSQLPGLSPGQRKLCQLYQEHMAYIGEGAKTGIKECQHQFRQRRWNCSTADNASVFGRVMQIGSRETAFTHAVSAAGVVNAISRACREGELSTCGCSRTARPKDLPRDWLWGGCGDNVEYGYRFAKEFVDAREREKNFAKGSEEQGRVLMNLQNNEAGRRAVYKMADVACKCHGVSGSCSLKTCWLQLAEFRKVGDRLKEKYDSAAAMRVTRKGRLELVNSRFTQPTPEDLVYVDPSPDYCLRNESTGSLGTQGRLCNKTSEGMDGCELMCCGRGYNQFKSVQVERCHCKFHWCCFVRCKKCTEIVDQYICK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1937-Ab Anti-WNT5B monoclonal antibody
    Target Antigen GM-Tg-g-MP1937-Ag WNT5B VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-MP1937 wingless-type MMTV integration site family, member 5B (WNT5B) protein & antibody
    ORF Viral Vector pGMLP004360 Human WNT5B Lentivirus plasmid
    ORF Viral Vector pGMLP005567 Human WNT5B Lentivirus plasmid
    ORF Viral Vector vGMLP004360 Human WNT5B Lentivirus particle
    ORF Viral Vector vGMLP005567 Human WNT5B Lentivirus particle


    Target information

    Target ID GM-MP1937
    Target Name WNT5B
    Gene ID 81029, 22419, 721685, 282582, 101085809, 486756, 508008, 100056017
    Gene Symbol and Synonyms Wnt-5b,WNT5B
    Uniprot Accession Q9H1J7
    Uniprot Entry Name WNT5B_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000111186
    Target Classification Not Available

    The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 94% and 80% amino acid identity to the mouse Wnt5b protein and the human WNT5A protein, respectively. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.