Human ANXA2/ANX2/ANX2L4 ORF/cDNA clone-Lentivirus plasmid (NM_004039.2)

Cat. No.: pGMLP004100
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human ANXA2/ANX2/ANX2L4 Lentiviral expression plasmid for ANXA2 lentivirus packaging, ANXA2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to ANXA2/ANX2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $585.6
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004100
Gene Name ANXA2
Accession Number NM_004039.2
Gene ID 302
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1020 bp
Gene Alias ANX2,ANX2L4,CAL1H,HEL-S-270,LIP2,LPC2,LPC2D,P36,PAP-IV
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCTACTGTTCACGAAATCCTGTGCAAGCTCAGCTTGGAGGGTGATCACTCTACACCCCCAAGTGCATATGGGTCTGTCAAAGCCTATACTAACTTTGATGCTGAGCGGGATGCTTTGAACATTGAAACAGCCATCAAGACCAAAGGTGTGGATGAGGTCACCATTGTCAACATTTTGACCAACCGCAGCAATGCACAGAGACAGGATATTGCCTTCGCCTACCAGAGAAGGACCAAAAAGGAACTTGCATCAGCACTGAAGTCAGCCTTATCTGGCCACCTGGAGACGGTGATTTTGGGCCTATTGAAGACACCTGCTCAGTATGACGCTTCTGAGCTAAAAGCTTCCATGAAGGGGCTGGGAACCGACGAGGACTCTCTCATTGAGATCATCTGCTCCAGAACCAACCAGGAGCTGCAGGAAATTAACAGAGTCTACAAGGAAATGTACAAGACTGATCTGGAGAAGGACATTATTTCGGACACATCTGGTGACTTCCGCAAGCTGATGGTTGCCCTGGCAAAGGGTAGAAGAGCAGAGGATGGCTCTGTCATTGATTATGAACTGATTGACCAAGATGCTCGGGATCTCTATGACGCTGGAGTGAAGAGGAAAGGAACTGATGTTCCCAAGTGGATCAGCATCATGACCGAGCGGAGCGTGCCCCACCTCCAGAAAGTATTTGATAGGTACAAGAGTTACAGCCCTTATGACATGTTGGAAAGCATCAGGAAAGAGGTTAAAGGAGACCTGGAAAATGCTTTCCTGAACCTGGTTCAGTGCATTCAGAACAAGCCCCTGTATTTTGCTGATCGGCTGTATGACTCCATGAAGGGCAAGGGGACGCGAGATAAGGTCCTGATCAGAATCATGGTCTCCCGCAGTGAAGTGGACATGTTGAAAATTAGGTCTGAATTCAAGAGAAAGTACGGCAAGTCCCTGTACTATTATATCCAGCAAGACACTAAGGGCGACTACCAGAAAGCGCTGCTGTACCTGTGTGGTGGAGATGACTGA
ORF Protein Sequence MSTVHEILCKLSLEGDHSTPPSAYGSVKAYTNFDAERDALNIETAIKTKGVDEVTIVNILTNRSNAQRQDIAFAYQRRTKKELASALKSALSGHLETVILGLLKTPAQYDASELKASMKGLGTDEDSLIEIICSRTNQELQEINRVYKEMYKTDLEKDIISDTSGDFRKLMVALAKGRRAEDGSVIDYELIDQDARDLYDAGVKRKGTDVPKWISIMTERSVPHLQKVFDRYKSYSPYDMLESIRKEVKGDLENAFLNLVQCIQNKPLYFADRLYDSMKGKGTRDKVLIRIMVSRSEVDMLKIRSEFKRKYGKSLYYYIQQDTKGDYQKALLYLCGGDD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T04386-Ab Anti-ANXA2/ ANX2/ ANX2L4 monoclonal antibody
    Target Antigen GM-Tg-g-T04386-Ag ANXA2 VLP (virus-like particle)
    ORF Viral Vector pGMLP004063 Human ANXA2 Lentivirus plasmid
    ORF Viral Vector pGMLP004100 Human ANXA2 Lentivirus plasmid
    ORF Viral Vector pGMLV000652 Human ANXA2 Lentivirus plasmid
    ORF Viral Vector pGMAP000385 Human ANXA2 Adenovirus plasmid
    ORF Viral Vector pGMPC000610 Human ANXA2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP004063 Human ANXA2 Lentivirus particle
    ORF Viral Vector vGMLP004100 Human ANXA2 Lentivirus particle
    ORF Viral Vector vGMLV000652 Human ANXA2 Lentivirus particle
    ORF Viral Vector vGMAP000385 Human ANXA2 Adenovirus particle


    Target information

    Target ID GM-T04386
    Target Name ANXA2
    Gene ID 302, 12306, 706240, 56611, 101093022, 403435, 282689, 100054320
    Gene Symbol and Synonyms Annexin-2,ANX2,ANX2L4,ANXA2,CAL1H,HEL-S-270,LIP2,LPC2,LPC2D,P36,PAP-IV
    Uniprot Accession P07355
    Uniprot Entry Name ANXA2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Ovary Cancer
    Gene Ensembl ENSG00000182718
    Target Classification Not Available

    This gene encodes a member of the annexin family. Members of this calcium-dependent phospholipid-binding protein family play a role in the regulation of cellular growth and in signal transduction pathways. This protein functions as an autocrine factor which heightens osteoclast formation and bone resorption. This gene has three pseudogenes located on chromosomes 4, 9 and 10, respectively. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. Annexin A2 expression has been found to correlate with resistance to treatment against various cancer forms. [provided by RefSeq, Dec 2019]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.