Human CNTFR ORF/cDNA clone-Lentivirus plasmid (NM_147164.2)

Cat. No.: pGMLP004075
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CNTFR/ Lentiviral expression plasmid for CNTFR lentivirus packaging, CNTFR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CNTFR/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $613.32
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004075
Gene Name CNTFR
Accession Number NM_147164.2
Gene ID 1271
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1119 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCTGCTCCTGTCCCGTGGGCCTGCTGTGCTGTGCTTGCCGCCGCCGCCGCAGTTGTCTACGCCCAGAGACACAGTCCACAGGAGGCACCCCATGTGCAGTACGAGCGCCTGGGCTCTGACGTGACACTGCCATGTGGGACAGCAAACTGGGATGCTGCGGTGACGTGGCGGGTAAATGGGACAGACCTGGCCCCTGACCTGCTCAACGGCTCTCAGCTGGTGCTCCATGGCCTGGAACTGGGCCACAGTGGCCTCTACGCCTGCTTCCACCGTGACTCCTGGCACCTGCGCCACCAAGTCCTGCTGCATGTGGGCTTGCCGCCGCGGGAGCCTGTGCTCAGCTGCCGCTCCAACACTTACCCCAAGGGCTTCTACTGCAGCTGGCATCTGCCCACCCCCACCTACATTCCCAACACCTTCAATGTGACTGTGCTGCATGGCTCCAAAATTATGGTCTGTGAGAAGGACCCAGCCCTCAAGAACCGCTGCCACATTCGCTACATGCACCTGTTCTCCACCATCAAGTACAAGGTCTCCATAAGTGTCAGCAATGCCCTGGGCCACAATGCCACAGCTATCACCTTTGACGAGTTCACCATTGTGAAGCCTGATCCTCCAGAAAATGTGGTAGCCCGGCCAGTGCCCAGCAACCCTCGCCGGCTGGAGGTGACGTGGCAGACCCCCTCGACCTGGCCTGACCCTGAGTCTTTTCCTCTCAAGTTCTTTCTGCGCTACCGACCCCTCATCCTGGACCAGTGGCAGCATGTGGAGCTGTCCGACGGCACAGCACACACCATCACAGATGCCTACGCCGGGAAGGAGTACATTATCCAGGTGGCAGCCAAGGACAATGAGATTGGGACATGGAGTGACTGGAGCGTAGCCGCCCACGCTACGCCCTGGACTGAGGAACCGCGACACCTCACCACGGAGGCCCAGGCTGCGGAGACCACGACCAGCACCACCAGCTCCCTGGCACCCCCACCTACCACGAAGATCTGTGACCCTGGGGAGCTGGGCAGCGGCGGGGGACCCTCGGCACCCTTCTTGGTCAGCGTCCCCATCACTCTGGCCCTGGCTGCCGCTGCCGCCACTGCCAGCAGTCTCTTGATCTGA
ORF Protein Sequence MAAPVPWACCAVLAAAAAVVYAQRHSPQEAPHVQYERLGSDVTLPCGTANWDAAVTWRVNGTDLAPDLLNGSQLVLHGLELGHSGLYACFHRDSWHLRHQVLLHVGLPPREPVLSCRSNTYPKGFYCSWHLPTPTYIPNTFNVTVLHGSKIMVCEKDPALKNRCHIRYMHLFSTIKYKVSISVSNALGHNATAITFDEFTIVKPDPPENVVARPVPSNPRRLEVTWQTPSTWPDPESFPLKFFLRYRPLILDQWQHVELSDGTAHTITDAYAGKEYIIQVAAKDNEIGTWSDWSVAAHATPWTEEPRHLTTEAQAAETTTSTTSSLAPPPTTKICDPGELGSGGGPSAPFLVSVPITLALAAAAATASSLLI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T61033-Ab Anti-CNTFR monoclonal antibody
    Target Antigen GM-Tg-g-T61033-Ag CNTFR VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T61033 ciliary neurotrophic factor receptor (CNTFR) protein & antibody
    ORF Viral Vector pGMLP004075 Human CNTFR Lentivirus plasmid
    ORF Viral Vector vGMLP004075 Human CNTFR Lentivirus particle


    Target information

    Target ID GM-T61033
    Target Name CNTFR
    Gene ID 1271, 12804, 700959, 313173, 101083719, 442941, 539548, 100146590
    Gene Symbol and Synonyms CNTFR,CNTFR-alpha,Cntfralpha
    Uniprot Accession P26992
    Uniprot Entry Name CNTFR_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000122756
    Target Classification Not Available

    This gene encodes a member of the type 1 cytokine receptor family. The encoded protein is the ligand-specific component of a tripartite receptor for ciliary neurotrophic factor, which plays a critical role in neuronal cell survival, differentiation and gene expression. Binding of ciliary neurotrophic factor to the encoded protein recruits the transmembrane components of the receptor, gp130 and leukemia inhibitory factor receptor, facilitating signal transduction. Single nucleotide polymorphisms in this gene may be associated with variations in muscle strength, as well as early onset of eating disorders. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.