Human RDH5 ORF/cDNA clone-Lentivirus plasmid (BC028298)

Cat. No.: pGMLP004058
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human RDH5/ Lentiviral expression plasmid for RDH5 lentivirus packaging, RDH5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to RDH5/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $539.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004058
Gene Name RDH5
Accession Number BC028298
Gene ID 5959
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 957 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTGGCTGCCTCTTCTGCTGGGTGCCTTACTCTGGGCAGTGCTGTGGTTGCTCAGGGACCGGCAGAGCCTGCCCGCCAGCAATGCCCTTGTCTTCATCACCGGCTGTGACTCAGGCTTTGGGCGCCTTCTGGCACTGCAGCTGGACCAGAGAGGCTTCCGAGTCCTGGCCAGCTGCCTGACCCCCTCCGGGGCCGAGGACCTGCAGCGGGTGGCCTCCTCCCGCCTCCACACCACCCTGTTGGATATCACTGATCCCCAGAGCGTCCAGCAGGCAGCCAAGTGGGTGGAGATGCACGTTAAGGAAGCAGGGCTTTTTGGTCTGGTGAATAATGCTGGTGTGGCTGGTATCATCGGACCCACACCATGGCTGACCCGGGACGATTTCCAGCGGGTGCTGAATGTGAACACAATGGGTCCCATCGGGGTCACCCTTGCCCTGCTGCCTCTGCTGCAGCAAGCCCGGGGCCGGGTGATCAACATCACCAGCGTCCTGGGTCGCCTGGCAGCCAATGGTGGGGGCTACTGTGTCTCCAAATTTGGCCTGGAGGCCTTCTCTGACAGCCTGAGGCGGGATGTAGCTCATTTTGGGATACGAGTCTCCATCGTGGAGCCTGGCTTCTTCCGAACCCCTGTGACCAACCTGGAGAGTCTGGAGAAAACCCTGCAGGCCTGCTGGGCACGGCTGCCTCCTGCCACACAGGCCCACTATGGGGGGGCCTTCCTCACCAAGTACCTGAAAATGCAACAGCGCATCATGAACCTGATCTGTGACCCGGACCTAACCAAGGTGAGCCGATGCCTGGAGCATGCCCTGACTGCTCGACACCCCCGAACCCGCTACAGCCCAGGTTGGGATGCCAAGCTGCTCTGGCTGCCTGCCTCCTACCTGCCAGCCAGCCTGGTGGATGCTGTGCTCACCTGGGTCCTTCCCAAGCCTGCCCAAGCAGTCTACTGA
ORF Protein Sequence MWLPLLLGALLWAVLWLLRDRQSLPASNALVFITGCDSGFGRLLALQLDQRGFRVLASCLTPSGAEDLQRVASSRLHTTLLDITDPQSVQQAAKWVEMHVKEAGLFGLVNNAGVAGIIGPTPWLTRDDFQRVLNVNTMGPIGVTLALLPLLQQARGRVINITSVLGRLAANGGGYCVSKFGLEAFSDSLRRDVAHFGIRVSIVEPGFFRTPVTNLESLEKTLQACWARLPPATQAHYGGAFLTKYLKMQQRIMNLICDPDLTKVSRCLEHALTARHPRTRYSPGWDAKLLWLPASYLPASLVDAVLTWVLPKPAQAVY

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1504-Ab Anti-RDH5/ 9cRDH/ HSD17B9 functional antibody
    Target Antigen GM-Tg-g-SE1504-Ag RDH5 protein
    ORF Viral Vector pGMLP004058 Human RDH5 Lentivirus plasmid
    ORF Viral Vector pGMAAV001539 Human RDH5 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV001540 Human RDH5 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector vGMLP004058 Human RDH5 Lentivirus particle
    ORF Viral Vector vGMAAV001539 Human RDH5 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV001540 Human RDH5 Adeno-associate virus(AAV) particle


    Target information

    Target ID GM-SE1504
    Target Name RDH5
    Gene ID 5959, 19682, 709644, 366791, 101090450, 481098, 281448, 100051379
    Gene Symbol and Synonyms 9-cis,9cRDH,cRDH,HSD17B9,P32,RDH1,RDH4,RDH5,SDR9C5
    Uniprot Accession Q92781
    Uniprot Entry Name RDH5_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000135437
    Target Classification Not Available

    This gene encodes an enzyme belonging to the short-chain dehydrogenases/reductases (SDR) family. This retinol dehydrogenase functions to catalyze the final step in the biosynthesis of 11-cis retinaldehyde, which is the universal chromophore of visual pigments. Mutations in this gene cause autosomal recessive fundus albipunctatus, a rare form of night blindness that is characterized by a delay in the regeneration of cone and rod photopigments. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring upstream BLOC1S1 (biogenesis of lysosomal organelles complex-1, subunit 1) gene. [provided by RefSeq, Dec 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.