Human HNMT/HMT/HNMT-S1 ORF/cDNA clone-Lentivirus plasmid (NM_006895)

Cat. No.: pGMLP003955
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human HNMT/HMT/HNMT-S1 Lentiviral expression plasmid for HNMT lentivirus packaging, HNMT lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to HNMT/HMT products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $519.75
Shipping fee: Limited-time free


Product Description

Catalog ID pGMLP003955
Gene Name HNMT
Accession Number NM_006895
Gene ID 3176
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 879 bp
Gene Alias HMT,HNMT-S1,HNMT-S2,MRT51
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCATCTTCCATGAGGAGCTTGTTTTCTGACCACGGGAAATATGTTGAATCTTTCCGGAGGTTTCTCAACCATTCCACGGAACACCAGTGCATGCAGGAATTCATGGACAAGAAGCTGCCAGGCATAATAGGAAGGATTGGAGACACAAAATCAGAAATTAAGATTCTAAGCATAGGCGGAGGTGCAGGTGAAATTGATCTTCAAATTCTCTCCAAAGTTCAGGCTCAATACCCAGGAGTTTGTATCAACAATGAAGTTGTTGAGCCAAGTGCTGAACAAATTGCCAAATACAAAGAGCTTGTAGCCAAGACATCGAACCTCGAGAACGTAAAGTTTGCTTGGCATAAGGAGACATCATCTGAATACCAAAGTAGAATGTTGGAGAAAAAGGAGCTTCAAAAGTGGGACTTTATTCATATGATTCAAATGCTGTATTATGTAAAAGACATCCCAGCTACCCTGAAATTCTTCCATAGTCTCTTAGGTACCAATGCTAAGATGCTCATTATTGTTGTGTCAGGAAGCAGTGGCTGGGACAAGCTGTGGAAAAAGTACGGATCACGCTTTCCCCAGGATGACCTCTGCCAGTATATCACATCAGATGACCTCACTCAGATGCTGGACAACCTAGGGCTTAAGTATGAGTGCTATGACCTTTTGTCCACCATGGATATATCTGACTGCTTTATTGATGGTAATGAAAATGGAGACCTGCTTTGGGATTTTTTGACTGAAACCTGCAACTTTAATGCCACAGCACCACCTGATCTCAGAGCAGAGCTTGGGAAAGATCTACAAGAGCCTGAATTTAGTGCTAAGAAAGAGGGGAAGGTTCTTTTTAATAATACTCTGAGTTTCATAGTGATTGAGGCATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T17448-Ab Anti-HNMT monoclonal antibody
    Target Antigen GM-Tg-g-T17448-Ag HNMT protein
    ORF Viral Vector pGMLP003955 Human HNMT Lentivirus plasmid
    ORF Viral Vector vGMLP003955 Human HNMT Lentivirus particle


    Target information

    Target ID GM-T17448
    Target Name HNMT
    Gene ID 3176, 140483, 81676, 101093704, 476133, 613413, 100051119
    Gene Symbol and Synonyms 1500031F01Rik,HMT,HNMT,HNMT-S1,HNMT-S2,MRT51
    Uniprot Accession P50135
    Uniprot Entry Name HNMT_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000150540
    Target Classification Not Available

    In mammals, histamine is metabolized by two major pathways: N(tau)-methylation via histamine N-methyltransferase and oxidative deamination via diamine oxidase. This gene encodes the first enzyme which is found in the cytosol and uses S-adenosyl-L-methionine as the methyl donor. In the mammalian brain, the neurotransmitter activity of histamine is controlled by N(tau)-methylation as diamine oxidase is not found in the central nervous system. A common genetic polymorphism affects the activity levels of this gene product in red blood cells. Multiple alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.