Human HNMT/HMT/ HNMT-S1 ORF/cDNA clone-Lentivirus plasmid (NM_006895)
Pre-made Human HNMT/HMT/ HNMT-S1 Lentiviral expression plasmid for HNMT lentivirus packaging, HNMT lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to HNMT/HMT products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003955 | Human HNMT Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003955 |
Gene Name | HNMT |
Accession Number | NM_006895 |
Gene ID | 3176 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 879 bp |
Gene Alias | HMT, HNMT-S1, HNMT-S2, MRT51 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCATCTTCCATGAGGAGCTTGTTTTCTGACCACGGGAAATATGTTGAATCTTTCCGGAGGTTTCTCAACCATTCCACGGAACACCAGTGCATGCAGGAATTCATGGACAAGAAGCTGCCAGGCATAATAGGAAGGATTGGAGACACAAAATCAGAAATTAAGATTCTAAGCATAGGCGGAGGTGCAGGTGAAATTGATCTTCAAATTCTCTCCAAAGTTCAGGCTCAATACCCAGGAGTTTGTATCAACAATGAAGTTGTTGAGCCAAGTGCTGAACAAATTGCCAAATACAAAGAGCTTGTAGCCAAGACATCGAACCTCGAGAACGTAAAGTTTGCTTGGCATAAGGAGACATCATCTGAATACCAAAGTAGAATGTTGGAGAAAAAGGAGCTTCAAAAGTGGGACTTTATTCATATGATTCAAATGCTGTATTATGTAAAAGACATCCCAGCTACCCTGAAATTCTTCCATAGTCTCTTAGGTACCAATGCTAAGATGCTCATTATTGTTGTGTCAGGAAGCAGTGGCTGGGACAAGCTGTGGAAAAAGTACGGATCACGCTTTCCCCAGGATGACCTCTGCCAGTATATCACATCAGATGACCTCACTCAGATGCTGGACAACCTAGGGCTTAAGTATGAGTGCTATGACCTTTTGTCCACCATGGATATATCTGACTGCTTTATTGATGGTAATGAAAATGGAGACCTGCTTTGGGATTTTTTGACTGAAACCTGCAACTTTAATGCCACAGCACCACCTGATCTCAGAGCAGAGCTTGGGAAAGATCTACAAGAGCCTGAATTTAGTGCTAAGAAAGAGGGGAAGGTTCTTTTTAATAATACTCTGAGTTTCATAGTGATTGAGGCATAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T17448-Ab | Anti-HNMT monoclonal antibody |
Target Antigen | GM-Tg-g-T17448-Ag | HNMT protein |
ORF Viral Vector | pGMLP003955 | Human HNMT Lentivirus plasmid |
ORF Viral Vector | vGMLP003955 | Human HNMT Lentivirus particle |
Target information
Target ID | GM-T17448 |
Target Name | HNMT |
Gene ID | 3176, 140483, 81676, 101093704, 476133, 613413, 100051119 |
Gene Symbol and Synonyms | 1500031F01Rik,HMT,HNMT,HNMT-S1,HNMT-S2,MRT51 |
Uniprot Accession | P50135 |
Uniprot Entry Name | HNMT_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000150540 |
Target Classification | Not Available |
In mammals, histamine is metabolized by two major pathways: N(tau)-methylation via histamine N-methyltransferase and oxidative deamination via diamine oxidase. This gene encodes the first enzyme which is found in the cytosol and uses S-adenosyl-L-methionine as the methyl donor. In the mammalian brain, the neurotransmitter activity of histamine is controlled by N(tau)-methylation as diamine oxidase is not found in the central nervous system. A common genetic polymorphism affects the activity levels of this gene product in red blood cells. Multiple alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.