Human MCU/C10orf42/CCDC109A ORF/cDNA clone-Lentivirus plasmid (NM_138357.2?)

SKU: pGMLP003937
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MCU/C10orf42/CCDC109A Lentiviral expression plasmid for MCU lentivirus packaging, MCU lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf MSDS
pdf Datasheet
pdf Terms of Use
pdf Map
Target products collection

Go to MCU/C10orf42 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $595.68
Shipping fee: Limited-time free


Product Description

Catalog ID pGMLP003937
Gene Name MCU
Accession Number NM_138357.2?
Gene ID 90550
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1056 bp
Gene Alias C10orf42,CCDC109A,HsMCU
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCGGCCGCCGCAGGTAGATCGCTCCTGCTGCTCCTCTCCTCTCGGGGCGGCGGCGGCGGGGGCGCCGGCGGCTGCGGGGCGCTGACTGCCGGCTGCTTCCCTGGGCTGGGCGTCAGCCGCCACCGGCAGCAGCAGCACCACCGGACGGTACACCAGAGGATCGCTTCCTGGCAGAATTTGGGAGCTGTTTATTGCAGCACTGTTGTGCCCTCTGATGATGTTACAGTGGTTTATCAAAATGGGTTACCTGTGATATCTGTGAGGCTACCATCCCGGCGTGAACGCTGTCAGTTCACACTCAAGCCTATCTCTGACTCTGTTGGTGTATTTTTACGACAACTGCAAGAAGAGGATCGGGGAATTGACAGAGTTGCTATCTATTCACCAGATGGTGTTCGCGTTGCTGCTTCAACAGGAATAGACCTCCTCCTCCTTGATGACTTTAAGCTGGTCATTAATGACTTAACATACCACGTACGACCACCAAAAAGAGACCTCTTAAGTCATGAAAATGCAGCAACGCTGAATGATGTAAAGACATTGGTCCAGCAACTATACACCACACTGTGCATTGAGCAGCACCAGTTAAACAAGGAAAGGGAGCTTATTGAAAGACTAGAGGATCTCAAAGAGCAGCTGGCTCCCCTGGAAAAGGTACGAATTGAGATTAGCAGAAAAGCTGAGAAGAGGACCACTTTGGTGCTATGGGGTGGCCTTGCCTACATGGCCACACAGTTTGGCATTTTGGCCCGGCTTACCTGGTGGGAATATTCCTGGGACATCATGGAGCCAGTAACATACTTCATCACTTATGGAAGTGCCATGGCAATGTATGCATATTTTGTAATGACACGCCAGGAATATGTTTATCCAGAAGCCAGAGACAGACAATACTTACTATTTTTCCATAAAGGAGCCAAAAAGTCACGTTTTGACCTAGAGAAATACAATCAACTCAAGGATGCAATTGCTCAGGCAGAAATGGACCTTAAGAGACTGAGAGACCCATTACAAGTACATCTGCCTCTCCGACAAATTGGTGAAAAAGATTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1160-Ab Anti-MCU monoclonal antibody
    Target Antigen GM-Tg-g-IP1160-Ag MCU protein
    ORF Viral Vector pGMLP003937 Human MCU Lentivirus plasmid
    ORF Viral Vector pGMLV002637 Human MCU Lentivirus plasmid
    ORF Viral Vector vGMLP003937 Human MCU Lentivirus particle
    ORF Viral Vector vGMLV002637 Human MCU Lentivirus particle


    Target information

    Target ID GM-IP1160
    Target Name MCU
    Gene ID 90550, 215999, 708334, 294560, 101083455, 489042, 536656, 100072824
    Gene Symbol and Synonyms 2010012O16Rik,C10orf42,CCDC109A,CCDC109B,D130073L02Rik,Gm64,HsMCU,MCU
    Uniprot Accession Q8NE86
    Uniprot Entry Name MCU_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000156026
    Target Classification Not Available

    This gene encodes a calcium transporter that localizes to the mitochondrial inner membrane. The encoded protein interacts with mitochondrial calcium uptake 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.