Human NOV/CCN3/IGFBP9 ORF/cDNA clone-Lentivirus plasmid (BC015028)

Cat. No.: pGMLP003882
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human NOV/CCN3/IGFBP9 Lentiviral expression plasmid for NOV lentivirus packaging, NOV lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf MSDS
pdf Datasheet
pdf Terms of Use
pdf Map
Target products collection

Go to CCN3/NOV products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $600.72
Shipping fee: Limited-time free


Product Description

Catalog ID pGMLP003882
Gene Name NOV
Accession Number BC015028
Gene ID 4856
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1074 bp
Gene Alias CCN3,IGFBP9,NOVH
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCAGAGTGTGCAGAGCACGAGCTTTTGTCTCCGAAAGCAGTGCCTTTGCCTGACCTTCCTGCTTCTCCATCTCCTGGGACAGGTCGCTGCGACTCAGCGCTGCCCTCCCCAGTGCCCGGGCCGGTGCCCTGCGACGCCGCCGACCTGCGCCCCCGGGGTGCGCGCGGTGCTGGACGGCTGCTCATGCTGTCTGGTGTGTGCCCGCCAGCGTGGCGAGAGCTGCTCAGATCTGGAGCCATGCGACGAGAGCAGTGGCCTCTACTGTGATCGCAGCGCGGACCCCAGCAAACAGACTGGCATCTGCACGGCGGTAGAGGGAGATAACTGTGTGTTCGATGGGGTCATCTACCGCAGTGGAGAGAAATTTCAGCCAAGCTGCAAATTCCAGTGCACCTGCAGAGATGGGCAGATTGGCTGTGTGCCCCGCTGTCAGCTGGATGTGCTACTGCCTGAGCCTAACTGCCCAGCTCCAAGAAAAGTTGAGGTGCCTGGAGAGTGCTGTGAAAAGTGGATCTGTGGCCCAGATGAGGAGGATTCACTGGGAGGCCTTACCCTTGCAGCTTACAGGCCAGAAGCCACCCTAGGAGTAGAAGTCTCTGACTCAAGTGTCAACTGCATTGAACAGACCACAGAGTGGACAGCATGCTCCAAGAGCTGTGGTATGGGGTTCTCCACCCGGGTCACCAATAGGAACCGTCAATGTGAGATGCTGAAACAGACTCGGCTCTGCATGGTGCGGCCCTGTGAACAAGAGCCAGAGCAGCCAACAGATAAGAAAGGAAAAAAGTGTCTCCGCACCAAGAAGTCACTCAAAGCCATCCACCTGCAGTTCAAGAACTGCACCAGCCTGCACACCTACAAGCCCAGGTTCTGTGGGGTCTGCAGTGATGGCCGCTGCTGCACTCCCCACAATACCAAAACCATCCAGGCAGAGTTTCAGTGCTCCCCAGGGCAAATAGTCAAGAAGCCAGTGATGGTCATTGGGACCTGCACCTGTCACACCAACTGTCCTAAGAACAATGAGGCCTTCCTCCAGGAGCTGGAGCTGAAGACTACCAGAGGGAAAATGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0752-Ab Anti-CCN3/ IBP-9/ IGFBP-9 functional antibody
    Target Antigen GM-Tg-g-SE0752-Ag CCN3 protein
    Cytokine cks-Tg-g-GM-SE0752 nephroblastoma overexpressed (NOV) protein & antibody
    ORF Viral Vector pGMLP003882 Human NOV Lentivirus plasmid
    ORF Viral Vector vGMLP003882 Human NOV Lentivirus particle


    Target information

    Target ID GM-SE0752
    Target Name CCN3
    Gene ID 4856, 18133, 702196, 81526, 101097377, 475083, 505727, 100057055
    Gene Symbol and Synonyms C130088N23Rik,CCN3,IBP-9,IGFBP-9,IGFBP9,NOV,NOVh
    Uniprot Accession P48745
    Uniprot Entry Name CCN3_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease gastric cancer
    Gene Ensembl ENSG00000136999
    Target Classification Not Available

    The protein encoded by this gene is a small secreted cysteine-rich protein and a member of the CCN family of regulatory proteins. CNN family proteins associate with the extracellular matrix and play an important role in cardiovascular and skeletal development, fibrosis and cancer development. [provided by RefSeq, Feb 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.