Human HVCN1/HV1/VSOP ORF/cDNA clone-Lentivirus plasmid (NM_001040107)

Cat. No.: pGMLP003854
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human HVCN1/HV1/VSOP Lentiviral expression plasmid for HVCN1 lentivirus packaging, HVCN1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to HVCN1/HV1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $505.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003854
Gene Name HVCN1
Accession Number NM_001040107
Gene ID 84329
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 822 bp
Gene Alias HV1,VSOP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCACCTGGGACGAAAAGGCAGTCACCCGCAGGGCCAAGGTGGCTCCCGCTGAGAGGATGAGCAAGTTCTTAAGGCACTTCACGGTCGTGGGAGACGACTACCATGCCTGGAACATCAACTACAAGAAATGGGAGAATGAAGAGGAGGAGGAGGAGGAGGAGCAGCCACCACCCACACCAGTCTCAGGCGAGGAAGGCAGAGCTGCAGCCCCTGACGTTGCCCCTGCCCCTGGCCCCGCACCCAGGGCCCCCCTTGACTTCAGGGGCATGTTGAGGAAACTGTTCAGCTCCCACAGGTTTCAGGTCATCATCATCTGCTTGGTGGTTCTGGATGCCCTCCTGGTGCTTGCTGAGCTCATCCTGGACCTGAAGATCATCCAGCCCGACAAGAATAACTATGCTGCCATGGTATTCCACTACATGAGCATCACCATCTTGGTCTTTTTTATGATGGAGATCATCTTTAAATTATTTGTCTTCCGCCTGGAGTTCTTTCACCACAAGTTTGAGATCCTGGATGCCGTCGTGGTGGTGGTCTCATTCATCCTCGACATTGTCCTCCTGTTCCAGGAGCACCAGTTTGAGGCTCTGGGCCTGCTGATTCTGCTCCGGCTGTGGCGGGTGGCCCGGATCATCAATGGGATTATCATCTCAGTTAAGACACGTTCAGAACGGCAACTCTTAAGGTTAAAACAGATGAATGTACAATTGGCCGCCAAGATTCAACACCTTGAGTTCAGCTGCTCTGAGAAGGAACAAGAAATTGAAAGACTTAACAAACTATTGCGACAGCATGGACTTCTTGGTGAAGTGAACTAG
ORF Protein Sequence MATWDEKAVTRRAKVAPAERMSKFLRHFTVVGDDYHAWNINYKKWENEEEEEEEEQPPPTPVSGEEGRAAAPDVAPAPGPAPRAPLDFRGMLRKLFSSHRFQVIIICLVVLDALLVLAELILDLKIIQPDKNNYAAMVFHYMSITILVFFMMEIIFKLFVFRLEFFHHKFEILDAVVVVVSFILDIVLLFQEHQFEALGLLILLRLWRVARIINGIIISVKTRSERQLLRLKQMNVQLAAKIQHLEFSCSEKEQEIERLNKLLRQHGLLGEVN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0595-Ab Anti-HVCN1/ HV1/ VSOP monoclonal antibody
    Target Antigen GM-Tg-g-MP0595-Ag HVCN1 VLP (virus-like particle)
    ORF Viral Vector pGMLP003854 Human HVCN1 Lentivirus plasmid
    ORF Viral Vector vGMLP003854 Human HVCN1 Lentivirus particle


    Target information

    Target ID GM-MP0595
    Target Name HVCN1
    Gene ID 84329, 74096, 709745, 304485, 101081003, 608547, 616570, 100051653
    Gene Symbol and Synonyms 0610039P13Rik,BTS,HV1,HVCN1,mVSOP,RGD1310788,VSOP,Vsop.
    Uniprot Accession Q96D96
    Uniprot Entry Name HVCN1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000122986
    Target Classification Not Available

    This gene encodes a voltage-gated protein channel protein expressed more highly in certain cells of the immune system. Phagocytic cells produce superoxide anions which require this channel protein, and in B cells this same process facilitates antibody production. This same channel protein, however, can also regulate functions in other cells including spermatozoa. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.