Human GRN/CLN11/ GEP ORF/cDNA clone-Lentivirus plasmid (NM_002087)
Pre-made Human GRN/CLN11/ GEP Lentiviral expression plasmid for GRN lentivirus packaging, GRN lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to PGRN/GRN/CLN11 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003819 | Human GRN Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003819 |
Gene Name | GRN |
Accession Number | NM_002087 |
Gene ID | 2896 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1782 bp |
Gene Alias | CLN11, GEP, GP88, PCDGF, PEPI, PGRN |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTGGACCCTGGTGAGCTGGGTGGCCTTAACAGCAGGGCTGGTGGCTGGAACGCGGTGCCCAGATGGTCAGTTCTGCCCTGTGGCCTGCTGCCTGGACCCCGGAGGAGCCAGCTACAGCTGCTGCCGTCCCCTTCTGGACAAATGGCCCACAACACTGAGCAGGCATCTGGGTGGCCCCTGCCAGGTTGATGCCCACTGCTCTGCCGGCCACTCCTGCATCTTTACCGTCTCAGGGACTTCCAGTTGCTGCCCCTTCCCAGAGGCCGTGGCATGCGGGGATGGCCATCACTGCTGCCCACGGGGCTTCCACTGCAGTGCAGACGGGCGATCCTGCTTCCAAAGATCAGGTAACAACTCCGTGGGTGCCATCCAGTGCCCTGATAGTCAGTTCGAATGCCCGGACTTCTCCACGTGCTGTGTTATGGTCGATGGCTCCTGGGGGTGCTGCCCCATGCCCCAGGCTTCCTGCTGTGAAGACAGGGTGCACTGCTGTCCGCACGGTGCCTTCTGCGACCTGGTTCACACCCGCTGCATCACACCCACGGGCACCCACCCCCTGGCAAAGAAGCTCCCTGCCCAGAGGACTAACAGGGCAGTGGCCTTGTCCAGCTCGGTCATGTGTCCGGACGCACGGTCCCGGTGCCCTGATGGTTCTACCTGCTGTGAGCTGCCCAGTGGGAAGTATGGCTGCTGCCCAATGCCCAACGCCACCTGCTGCTCCGATCACCTGCACTGCTGCCCCCAAGACACTGTGTGTGACCTGATCCAGAGTAAGTGCCTCTCCAAGGAGAACGCTACCACGGACCTCCTCACTAAGCTGCCTGCGCACACAGTGGGGGATGTGAAATGTGACATGGAGGTGAGCTGCCCAGATGGCTATACCTGCTGCCGTCTACAGTCGGGGGCCTGGGGCTGCTGCCCTTTTACCCAGGCTGTGTGCTGTGAGGACCACATACACTGCTGTCCCGCGGGGTTTACGTGTGACACGCAGAAGGGTACCTGTGAACAGGGGCCCCACCAGGTGCCCTGGATGGAGAAGGCCCCAGCTCACCTCAGCCTGCCAGACCCACAAGCCTTGAAGAGAGATGTCCCCTGTGATAATGTCAGCAGCTGTCCCTCCTCCGATACCTGCTGCCAACTCACGTCTGGGGAGTGGGGCTGCTGTCCAATCCCAGAGGCTGTCTGCTGCTCGGACCACCAGCACTGCTGCCCCCAGGGCTACACGTGTGTAGCTGAGGGGCAGTGTCAGCGAGGAAGCGAGATCGTGGCTGGACTGGAGAAGATGCCTGCCCGCCGGGCTTCCTTATCCCACCCCAGAGACATCGGCTGTGACCAGCACACCAGCTGCCCGGTGGGGCAGACCTGCTGCCCGAGCCTGGGTGGGAGCTGGGCCTGCTGCCAGTTGCCCCATGCTGTGTGCTGCGAGGATCGCCAGCACTGCTGCCCGGCTGGCTACACCTGCAACGTGAAGGCTCGATCCTGCGAGAAGGAAGTGGTCTCTGCCCAGCCTGCCACCTTCCTGGCCCGTAGCCCTCACGTGGGTGTGAAGGACGTGGAGTGTGGGGAAGGACACTTCTGCCATGATAACCAGACCTGCTGCCGAGACAACCGACAGGGCTGGGCCTGCTGTCCCTACCGCCAGGGCGTCTGTTGTGCTGATCGGCGCCACTGCTGTCCTGCTGGCTTCCGCTGCGCAGCCAGGGGTACCAAGTGTTTGCGCAGGGAGGCCCCGCGCTGGGACGCCCCTTTGAGGGACCCAGCCTTGAGACAGCTGCTGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T45182-Ab | Anti-GRN/ PGRN/ CLN11 monoclonal antibody |
Target Antigen | GM-Tg-g-T45182-Ag | PGRN/GRN VLP (virus-like particle) |
ORF Viral Vector | pGMLP003819 | Human GRN Lentivirus plasmid |
ORF Viral Vector | pGMAP000509 | Human GRN Adenovirus plasmid |
ORF Viral Vector | vGMLP003819 | Human GRN Lentivirus particle |
ORF Viral Vector | vGMAP000509 | Human GRN Adenovirus particle |
Target information
Target ID | GM-T45182 |
Target Name | PGRN |
Gene ID | 2896, 14824, 714851, 29143, 101100680, 480501, 767942, 100051035 |
Gene Symbol and Synonyms | CLN11,epithelin,GEP,GP88,GRN,PCDGF,PEPI,PGRN |
Uniprot Accession | P28799 |
Uniprot Entry Name | GRN_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Ovary Cancer, Type 1 diabetes mellitus |
Gene Ensembl | ENSG00000030582 |
Target Classification | Not Available |
Granulins are a family of secreted, glycosylated peptides that are cleaved from a single precursor protein with 7.5 repeats of a highly conserved 12-cysteine granulin/epithelin motif. The 88 kDa precursor protein, progranulin, is also called proepithelin and PC cell-derived growth factor. Cleavage of the signal peptide produces mature granulin which can be further cleaved into a variety of active, 6 kDa peptides. These smaller cleavage products are named granulin A, granulin B, granulin C, etc. Epithelins 1 and 2 are synonymous with granulins A and B, respectively. Both the peptides and intact granulin protein regulate cell growth. However, different members of the granulin protein family may act as inhibitors, stimulators, or have dual actions on cell growth. Granulin family members are important in normal development, wound healing, and tumorigenesis. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.