Human ADRA2A/ADRA2/ADRA2R ORF/cDNA clone-Lentivirus plasmid (NM_000681)

Cat. No.: pGMLP003730
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human ADRA2A/ADRA2/ADRA2R Lentiviral expression plasmid for ADRA2A lentivirus packaging, ADRA2A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to ADRA2A/ADRA2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $691.44
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003730
Gene Name ADRA2A
Accession Number NM_000681
Gene ID 150
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1398 bp
Gene Alias ADRA2,ADRA2R,ADRAR,ALPHA2AAR,ZNF32
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTTCCGCCAGGAGCAGCCGTTGGCCGAGGGCAGCTTTGCGCCCATGGGCTCCCTGCAGCCGGACGCGGGCAACGCGAGCTGGAACGGGACCGAGGCGCCGGGGGGCGGCGCCCGGGCCACCCCTTACTCCCTGCAGGTGACGCTGACGCTGGTGTGCCTGGCCGGCCTGCTCATGCTGCTCACCGTGTTCGGCAACGTGCTCGTCATCATCGCCGTGTTCACGAGCCGCGCGCTCAAGGCGCCCCAAAACCTCTTCCTGGTGTCTCTGGCCTCGGCCGACATCCTGGTGGCCACGCTCGTCATCCCTTTCTCGCTGGCCAACGAGGTCATGGGCTACTGGTACTTCGGCAAGGCTTGGTGCGAGATCTACCTGGCGCTCGACGTGCTCTTCTGCACGTCGTCCATCGTGCACCTGTGCGCCATCAGCCTGGACCGCTACTGGTCCATCACACAGGCCATCGAGTACAACCTGAAGCGCACGCCGCGCCGCATCAAGGCCATCATCATCACCGTGTGGGTCATCTCGGCCGTCATCTCCTTCCCGCCGCTCATCTCCATCGAGAAGAAGGGCGGCGGCGGCGGCCCGCAGCCGGCCGAGCCGCGCTGCGAGATCAACGACCAGAAGTGGTACGTCATCTCGTCGTGCATCGGCTCCTTCTTCGCTCCCTGCCTCATCATGATCCTGGTCTACGTGCGCATCTACCAGATCGCCAAGCGTCGCACCCGCGTGCCACCCAGCCGCCGGGGTCCGGACGCCGTCGCCGCGCCGCCGGGGGGCACCGAGCGCAGGCCCAACGGTCTGGGCCCCGAGCGCAGCGCGGGCCCGGGGGGCGCAGAGGCCGAACCGCTGCCCACCCAGCTCAACGGCGCCCCTGGCGAGCCCGCGCCGGCCGGGCCGCGCGACACCGACGCGCTGGACCTGGAGGAGAGCTCGTCTTCCGACCACGCCGAGCGGCCTCCAGGGCCCCGCAGACCCGAGCGCGGTCCCCGGGGCAAAGGCAAGGCCCGAGCGAGCCAGGTGAAGCCGGGCGACAGCCTGCCGCGGCGCGGGCCGGGGGCGACGGGGATCGGGACGCCGGCTGCAGGGCCGGGGGAGGAGCGCGTCGGGGCTGCCAAGGCGTCGCGCTGGCGCGGGCGGCAGAACCGCGAGAAGCGCTTCACGTTCGTGCTGGCCGTGGTCATCGGAGTGTTCGTGGTGTGCTGGTTCCCCTTCTTCTTCACCTACACGCTCACGGCCGTCGGGTGCTCCGTGCCACGCACGCTCTTCAAATTCTTCTTCTGGTTCGGCTACTGCAACAGCTCGTTGAACCCGGTCATCTACACCATCTTCAACCACGATTTCCGCCGCGCCTTCAAGAAGATCCTCTGTCGGGGGGACAGGAAGCGGATCGTGTGA
ORF Protein Sequence MFRQEQPLAEGSFAPMGSLQPDAGNASWNGTEAPGGGARATPYSLQVTLTLVCLAGLLMLLTVFGNVLVIIAVFTSRALKAPQNLFLVSLASADILVATLVIPFSLANEVMGYWYFGKAWCEIYLALDVLFCTSSIVHLCAISLDRYWSITQAIEYNLKRTPRRIKAIIITVWVISAVISFPPLISIEKKGGGGGPQPAEPRCEINDQKWYVISSCIGSFFAPCLIMILVYVRIYQIAKRRTRVPPSRRGPDAVAAPPGGTERRPNGLGPERSAGPGGAEAEPLPTQLNGAPGEPAPAGPRDTDALDLEESSSSDHAERPPGPRRPERGPRGKGKARASQVKPGDSLPRRGPGATGIGTPAAGPGEERVGAAKASRWRGRQNREKRFTFVLAVVIGVFVVCWFPFFFTYTLTAVGCSVPRTLFKFFFWFGYCNSSLNPVIYTIFNHDFRRAFKKILCRGDRKRIV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T11448-Ab Anti-ADA2A/ ADRA2A/ ADRA2 monoclonal antibody
    Target Antigen GM-Tg-g-T11448-Ag ADRA2A VLP (virus-like particle)
    ORF Viral Vector pGMLP003730 Human ADRA2A Lentivirus plasmid
    ORF Viral Vector vGMLP003730 Human ADRA2A Lentivirus particle


    Target information

    Target ID GM-T11448
    Target Name ADRA2A
    Gene ID 150, 11551, 695684, 25083, 664736, 486888, 282135, 100147119
    Gene Symbol and Synonyms Adra-2,Adra-2a,ADRA2,ADRA2A,ADRA2R,ADRAR,alpha(2A)AR,alpha2-C10,alpha2A,alpha2A-AR,ALPHA2AAR,CA2-47,RATRG20,RG20,ZNF32
    Uniprot Accession P08913
    Uniprot Entry Name ADA2A_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000150594
    Target Classification GPCR

    Alpha-2-adrenergic receptors are members of the G protein-coupled receptor superfamily. The alpha-2-adrenergic receptors are a type of adrenergic receptors (for adrenaline or epinephrine), which inhibit adenylate cyclase. These receptors include 3 highly homologous subtypes: alpha2A, alpha2B, and alpha2C. They are involved in regulating the release of neurotransmitter molecules from sympathetic nerves and from adrenergic neurons in the central nervous system. The sympathetic nervous system regulates cardiovascular function by activating adrenergic receptors in the heart, blood vessels and kidney. Studies in mouse revealed that both the alpha2A and alpha2C receptor subtypes were required for presynaptic transmitter release from the sympathetic nervous system in the heart and from central noradrenergic neurons. The alpha-2-adrenergic receptors are also involved in catecholamine signaling by extracellular regulated protein kinase 1 and 2 (ERK1/2) pathways. A clear association between the alpha-2-adrenergic receptor and disease has not been yet established. [provided by RefSeq, Sep 2019]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.