Human NGFR/CD271/Gp80-LNGFR ORF/cDNA clone-Lentivirus plasmid (NM_002507)

SKU: pGMLP003686
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human NGFR/CD271/Gp80-LNGFR Lentiviral expression plasmid for NGFR lentivirus packaging, NGFR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf MSDS
pdf Datasheet
pdf Terms of Use
pdf Map
Target products collection

Go to NGFR/CD271 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $659.52
Shipping fee: Limited-time free


Product Description

Catalog ID pGMLP003686
Gene Name NGFR
Accession Number NM_002507
Gene ID 4804
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1284 bp
Gene Alias CD271,Gp80-LNGFR,p75(NTR),p75NTR,TNFRSF16
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGGGCAGGTGCCACCGGCCGCGCCATGGACGGGCCGCGCCTGCTGCTGTTGCTGCTTCTGGGGGTGTCCCTTGGAGGTGCCAAGGAGGCATGCCCCACAGGCCTGTACACACACAGCGGTGAGTGCTGCAAAGCCTGCAACCTGGGCGAGGGTGTGGCCCAGCCTTGTGGAGCCAACCAGACCGTGTGTGAGCCCTGCCTGGACAGCGTGACGTTCTCCGACGTGGTGAGCGCGACCGAGCCGTGCAAGCCGTGCACCGAGTGCGTGGGGCTCCAGAGCATGTCGGCGCCGTGCGTGGAGGCCGACGACGCCGTGTGCCGCTGCGCCTACGGCTACTACCAGGATGAGACGACTGGGCGCTGCGAGGCGTGCCGCGTGTGCGAGGCGGGCTCGGGCCTCGTGTTCTCCTGCCAGGACAAGCAGAACACCGTGTGCGAGGAGTGCCCCGACGGCACGTATTCCGACGAGGCCAACCACGTGGACCCGTGCCTGCCCTGCACCGTGTGCGAGGACACCGAGCGCCAGCTCCGCGAGTGCACACGCTGGGCCGACGCCGAGTGCGAGGAGATCCCTGGCCGTTGGATTACACGGTCCACACCCCCAGAGGGCTCGGACAGCACAGCCCCCAGCACCCAGGAGCCTGAGGCACCTCCAGAACAAGACCTCATAGCCAGCACGGTGGCAGGTGTGGTGACCACAGTGATGGGCAGCTCCCAGCCCGTGGTGACCCGAGGCACCACCGACAACCTCATCCCTGTCTATTGCTCCATCCTGGCTGCTGTGGTTGTGGGCCTTGTGGCCTACATAGCCTTCAAGAGGTGGAACAGCTGCAAGCAGAACAAGCAAGGAGCCAACAGCCGGCCAGTGAACCAGACGCCCCCACCAGAGGGAGAAAAACTCCACAGCGACAGTGGCATCTCCGTGGACAGCCAGAGCCTGCATGACCAGCAGCCCCACACGCAGACAGCCTCGGGCCAGGCCCTCAAGGGTGACGGAGGCCTCTACAGCAGCCTGCCCCCAGCCAAGCGGGAGGAGGTGGAGAAGCTTCTCAACGGCTCTGCGGGGGACACCTGGCGGCACCTGGCGGGCGAGCTGGGCTACCAGCCCGAGCACATAGACTCCTTTACCCATGAGGCCTGCCCCGTTCGCGCCCTGCTTGCAAGCTGGGCCACCCAGGACAGCGCCACACTGGACGCCCTCCTGGCCGCCCTGCGCCGCATCCAGCGAGCCGACCTCGTGGAGAGTCTGTGCAGTGAGTCCACTGCCACATCCCCGGTGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T50942-Ab Anti-TNR16/ NGFR/ CD271 monoclonal antibody
    Target Antigen GM-Tg-g-T50942-Ag NGFR VLP (virus-like particle)
    ORF Viral Vector pGMLP003686 Human NGFR Lentivirus plasmid
    ORF Viral Vector vGMLP003686 Human NGFR Lentivirus particle


    Target information

    Target ID GM-T50942
    Target Name NGFR
    Gene ID 4804, 18053, 574304, 24596, 101101519, 491071, 353110, 100069694
    Gene Symbol and Synonyms CD271,Gp80-LNGFR,LNGFR,NGFR,p75,p75(NTR),p75NGFR,p75NTR,RNNGFRR,TNFRSF16
    Uniprot Accession P08138
    Uniprot Entry Name TNR16_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000064300
    Target Classification Tumor-associated antigen (TAA)

    Nerve growth factor receptor contains an extracellular domain containing four 40-amino acid repeats with 6 cysteine residues at conserved positions followed by a serine/threonine-rich region, a single transmembrane domain, and a 155-amino acid cytoplasmic domain. The cysteine-rich region contains the nerve growth factor binding domain. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.