Human HTR1A/5-HT-1A/5-HT1A ORF/cDNA clone-Lentivirus plasmid (NM_000524)

Cat. No.: pGMLP003677
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human HTR1A/5-HT-1A/5-HT1A Lentiviral expression plasmid for HTR1A lentivirus packaging, HTR1A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to HTR1A/5-HT-1A products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $655.32
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003677
Gene Name HTR1A
Accession Number NM_000524
Gene ID 3350
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1269 bp
Gene Alias 5-HT-1A,5-HT1A,5HT1a,ADRB2RL1,ADRBRL1,G-21,PFMCD
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGATGTGCTCAGCCCTGGTCAGGGCAACAACACCACATCACCACCGGCTCCCTTTGAGACCGGCGGCAACACTACTGGTATCTCCGACGTGACCGTCAGCTACCAAGTGATCACCTCTCTGCTGCTGGGCACGCTCATCTTCTGCGCGGTGCTGGGCAATGCGTGCGTGGTGGCTGCCATCGCCTTGGAGCGCTCCCTGCAGAACGTGGCCAATTATCTTATTGGCTCTTTGGCGGTCACCGACCTCATGGTGTCGGTGTTGGTGCTGCCCATGGCCGCGCTGTATCAGGTGCTCAACAAGTGGACACTGGGCCAGGTAACCTGCGACCTGTTCATCGCCCTCGACGTGCTGTGCTGCACCTCATCCATCTTGCACCTGTGCGCCATCGCGCTGGACAGGTACTGGGCCATCACGGACCCCATCGACTACGTGAACAAGAGGACGCCCCGGCGCGCCGCTGCGCTCATCTCGCTCACTTGGCTTATTGGCTTCCTCATCTCTATCCCGCCCATGCTGGGCTGGCGCACCCCGGAAGACCGCTCGGACCCCGACGCATGCACCATTAGCAAGGATCATGGCTACACTATCTATTCCACCTTTGGAGCTTTCTACATCCCGCTGCTGCTCATGCTGGTTCTCTATGGGCGCATATTCCGAGCTGCGCGCTTCCGCATCCGCAAGACGGTCAAAAAGGTGGAGAAGACCGGAGCGGACACCCGCCATGGAGCATCTCCCGCCCCGCAGCCCAAGAAGAGTGTGAATGGAGAGTCGGGGAGCAGGAACTGGAGGCTGGGCGTGGAGAGCAAGGCTGGGGGTGCTCTGTGCGCCAATGGCGCGGTGAGGCAAGGTGACGATGGCGCCGCCCTGGAGGTGATCGAGGTGCACCGAGTGGGCAACTCCAAAGAGCACTTGCCTCTGCCCAGCGAGGCTGGTCCTACCCCTTGTGCCCCCGCCTCTTTCGAGAGGAAAAATGAGCGCAACGCCGAGGCGAAGCGCAAGATGGCCCTGGCCCGAGAGAGGAAGACAGTGAAGACGCTGGGCATCATCATGGGCACCTTCATCCTCTGCTGGCTGCCCTTCTTCATCGTGGCTCTTGTTCTGCCCTTCTGCGAGAGCAGCTGCCACATGCCCACCCTGTTGGGCGCCATAATCAATTGGCTGGGCTACTCCAACTCTCTGCTTAACCCCGTCATTTACGCATACTTCAACAAGGACTTTCAAAACGCGTTTAAGAAGATCATTAAGTGTAAGTTCTGCCGCCAGTGA
ORF Protein Sequence MDVLSPGQGNNTTSPPAPFETGGNTTGISDVTVSYQVITSLLLGTLIFCAVLGNACVVAAIALERSLQNVANYLIGSLAVTDLMVSVLVLPMAALYQVLNKWTLGQVTCDLFIALDVLCCTSSILHLCAIALDRYWAITDPIDYVNKRTPRRAAALISLTWLIGFLISIPPMLGWRTPEDRSDPDACTISKDHGYTIYSTFGAFYIPLLLMLVLYGRIFRAARFRIRKTVKKVEKTGADTRHGASPAPQPKKSVNGESGSRNWRLGVESKAGGALCANGAVRQGDDGAALEVIEVHRVGNSKEHLPLPSEAGPTPCAPASFERKNERNAEAKRKMALARERKTVKTLGIIMGTFILCWLPFFIVALVLPFCESSCHMPTLLGAIINWLGYSNSLLNPVIYAYFNKDFQNAFKKIIKCKFCRQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T78709-Ab Anti-5HT1A/ HTR1A/ 5-HT-1A monoclonal antibody
    Target Antigen GM-Tg-g-T78709-Ag HTR1A VLP (virus-like particle)
    ORF Viral Vector pGMLP003677 Human HTR1A Lentivirus plasmid
    ORF Viral Vector vGMLP003677 Human HTR1A Lentivirus particle


    Target information

    Target ID GM-T78709
    Target Name HTR1A
    Gene ID 3350, 15550, 694991, 24473, 101101542, 487230, 407137, 100009683
    Gene Symbol and Synonyms 5-HT-1A,5-HT1A,5HT1a,5htr1a,ADRB2RL1,ADRBRL1,G-21,Gpcr18,HTR1A,PFMCD,RAT5HT1A
    Uniprot Accession P08908
    Uniprot Entry Name 5HT1A_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000178394
    Target Classification GPCR

    This gene encodes a G protein-coupled receptor for 5-hydroxytryptamine (serotonin), and belongs to the 5-hydroxytryptamine receptor subfamily. Serotonin has been implicated in a number of physiologic processes and pathologic conditions. Inactivation of this gene in mice results in behavior consistent with an increased anxiety and stress response. Mutation in the promoter of this gene has been associated with menstrual cycle-dependent periodic fevers. [provided by RefSeq, Jun 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.