Human CXCR5/BLR1/CD185 ORF/cDNA clone-Lentivirus plasmid (NM_001716)

Cat. No.: pGMLP003601
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CXCR5/BLR1/CD185 Lentiviral expression plasmid for CXCR5 lentivirus packaging, CXCR5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CXCR5/BLR1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $613.32
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003601
Gene Name CXCR5
Accession Number NM_001716
Gene ID 643
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1119 bp
Gene Alias BLR1,CD185,MDR15
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAACTACCCGCTAACGCTGGAAATGGACCTCGAGAACCTGGAGGACCTGTTCTGGGAACTGGACAGATTGGACAACTATAACGACACCTCCCTGGTGGAAAATCATCTCTGCCCTGCCACAGAGGGGCCCCTCATGGCCTCCTTCAAGGCCGTGTTCGTGCCCGTGGCCTACAGCCTCATCTTCCTCCTGGGCGTGATCGGCAACGTCCTGGTGCTGGTGATCCTGGAGCGGCACCGGCAGACACGCAGTTCCACGGAGACCTTCCTGTTCCACCTGGCCGTGGCCGACCTCCTGCTGGTCTTCATCTTGCCCTTTGCCGTGGCCGAGGGCTCTGTGGGCTGGGTCCTGGGGACCTTCCTCTGCAAAACTGTGATTGCCCTGCACAAAGTCAACTTCTACTGCAGCAGCCTGCTCCTGGCCTGCATCGCCGTGGACCGCTACCTGGCCATTGTCCACGCCGTCCATGCCTACCGCCACCGCCGCCTCCTCTCCATCCACATCACCTGTGGGACCATCTGGCTGGTGGGCTTCCTCCTTGCCTTGCCAGAGATTCTCTTCGCCAAAGTCAGCCAAGGCCATCACAACAACTCCCTGCCACGTTGCACCTTCTCCCAAGAGAACCAAGCAGAAACGCATGCCTGGTTCACCTCCCGATTCCTCTACCATGTGGCGGGATTCCTGCTGCCCATGCTGGTGATGGGCTGGTGCTACGTGGGGGTAGTGCACAGGTTGCGCCAGGCCCAGCGGCGCCCTCAGCGGCAGAAGGCAGTCAGGGTGGCCATCCTGGTGACAAGCATCTTCTTCCTCTGCTGGTCACCCTACCACATCGTCATCTTCCTGGACACCCTGGCGAGGCTGAAGGCCGTGGACAATACCTGCAAGCTGAATGGCTCTCTCCCCGTGGCCATCACCATGTGTGAGTTCCTGGGCCTGGCCCACTGCTGCCTCAACCCCATGCTCTACACTTTCGCCGGCGTGAAGTTCCGCAGTGACCTGTCGCGGCTCCTGACGAAGCTGGGCTGTACCGGCCCTGCCTCCCTGTGCCAGCTCTTCCCTAGCTGGCGCAGGAGCAGTCTCTCTGAGTCAGAGAATGCCACCTCTCTCACCACGTTCTAG
ORF Protein Sequence MNYPLTLEMDLENLEDLFWELDRLDNYNDTSLVENHLCPATEGPLMASFKAVFVPVAYSLIFLLGVIGNVLVLVILERHRQTRSSTETFLFHLAVADLLLVFILPFAVAEGSVGWVLGTFLCKTVIALHKVNFYCSSLLLACIAVDRYLAIVHAVHAYRHRRLLSIHITCGTIWLVGFLLALPEILFAKVSQGHHNNSLPRCTFSQENQAETHAWFTSRFLYHVAGFLLPMLVMGWCYVGVVHRLRQAQRRPQRQKAVRVAILVTSIFFLCWSPYHIVIFLDTLARLKAVDNTCKLNGSLPVAITMCEFLGLAHCCLNPMLYTFAGVKFRSDLSRLLTKLGCTGPASLCQLFPSWRRSSLSESENATSLTTF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T09528-Ab Anti-CXCR5/ BLR1/ CD185 monoclonal antibody
    Target Antigen GM-Tg-g-T09528-Ag CXCR5 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T09528 chemokine (C-X-C motif) receptor 5 (CXCR5) protein & antibody
    ORF Viral Vector pGMLP003601 Human CXCR5 Lentivirus plasmid
    ORF Viral Vector pGMPC004865 Human CXCR5 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC004922 Human CXCR5 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP003601 Human CXCR5 Lentivirus particle


    Target information

    Target ID GM-T09528
    Target Name CXCR5
    Gene ID 643, 12145, 701792, 29363, 101092459, 489378, 497021
    Gene Symbol and Synonyms BLR1,CD185,CXC-R5,CXCR-5,CXCR5,Gpcr6,MDR15,NLR
    Uniprot Accession P32302
    Uniprot Entry Name CXCR5_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000160683
    Target Classification Checkpoint-Immuno Oncology, GPCR

    This gene encodes a multi-pass membrane protein that belongs to the CXC chemokine receptor family. It is expressed in mature B-cells and Burkitt's lymphoma. This cytokine receptor binds to B-lymphocyte chemoattractant (BLC), and is involved in B-cell migration into B-cell follicles of spleen and Peyer patches. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.