Human LRPAP1/A2MRAP/A2RAP ORF/cDNA clone-Lentivirus plasmid (NM_002337)

Cat. No.: pGMLP003583
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human LRPAP1/A2MRAP/A2RAP Lentiviral expression plasmid for LRPAP1 lentivirus packaging, LRPAP1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to LRPAP1/A2MRAP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $600.72
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003583
Gene Name LRPAP1
Accession Number NM_002337
Gene ID 4043
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1074 bp
Gene Alias A2MRAP,A2RAP,alpha-2-MRAP,HBP44,MRAP,MYP23,RAP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGCCGCGGAGGGTCAGGTCGTTTCTGCGCGGGCTCCCGGCGCTGCTACTGCTGCTGCTCTTCCTCGGGCCCTGGCCCGCTGCGAGCCACGGCGGCAAGTACTCGCGGGAGAAGAACCAGCCCAAGCCGTCCCCGAAACGCGAGTCCGGAGAGGAGTTCCGCATGGAGAAGTTGAACCAGCTGTGGGAGAAGGCCCAGCGACTGCATCTTCCTCCCGTGAGGCTGGCCGAGCTCCACGCTGATCTGAAGATACAGGAGAGGGACGAACTCGCCTGGAAGAAACTAAAGCTTGACGGCTTGGACGAAGATGGGGAGAAGGAAGCGAGACTCATACGCAACCTCAATGTCATCTTGGCCAAGTATGGTCTGGACGGAAAGAAGGACGCTCGGCAGGTGACCAGCAACTCCCTCAGTGGCACCCAGGAAGACGGGCTGGATGACCCCAGGCTGGAAAAGCTGTGGCACAAGGCGAAGACCTCTGGGAAATTCTCCGGCGAAGAACTGGACAAGCTCTGGCGGGAGTTCCTGCATCACAAAGAGAAAGTTCACGAGTACAACGTCCTGCTGGAGACCCTGAGCAGGACCGAAGAAATCCACGAGAACGTCATTAGCCCCTCGGACCTGAGCGACATCAAGGGCAGCGTCCTGCACAGCAGGCACACGGAGCTGAAGGAGAAGCTGCGCAGCATCAACCAGGGCCTGGACCGCCTGCGCAGGGTCAGCCACCAGGGCTACAGCACTGAGGCTGAGTTCGAGGAGCCCAGGGTGATTGACCTGTGGGACCTGGCGCAGTCCGCCAACCTCACGGACAAGGAGCTGGAGGCGTTCCGGGAGGAGCTCAAGCACTTCGAAGCCAAAATCGAGAAGCACAACCACTACCAGAAGCAGCTGGAGATTGCGCACGAGAAGCTGAGGCACGCAGAGAGCGTGGGCGACGGCGAGCGTGTGAGCCGCAGCCGCGAGAAGCACGCCCTGCTGGAGGGGCGGACCAAGGAGCTGGGCTACACGGTGAAGAAGCATCTGCAGGACCTGTCCGGCAGGATCTCCAGAGCTCGGCACAACGAACTCTGA
ORF Protein Sequence MAPRRVRSFLRGLPALLLLLLFLGPWPAASHGGKYSREKNQPKPSPKRESGEEFRMEKLNQLWEKAQRLHLPPVRLAELHADLKIQERDELAWKKLKLDGLDEDGEKEARLIRNLNVILAKYGLDGKKDARQVTSNSLSGTQEDGLDDPRLEKLWHKAKTSGKFSGEELDKLWREFLHHKEKVHEYNVLLETLSRTEEIHENVISPSDLSDIKGSVLHSRHTELKEKLRSINQGLDRLRRVSHQGYSTEAEFEEPRVIDLWDLAQSANLTDKELEAFREELKHFEAKIEKHNHYQKQLEIAHEKLRHAESVGDGERVSRSREKHALLEGRTKELGYTVKKHLQDLSGRISRARHNEL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0759-Ab Anti-AMRP/ LRPAP1/ A2MRAP monoclonal antibody
    Target Antigen GM-Tg-g-MP0759-Ag LRPAP1 VLP (virus-like particle)
    ORF Viral Vector pGMLP003583 Human LRPAP1 Lentivirus plasmid
    ORF Viral Vector vGMLP003583 Human LRPAP1 Lentivirus particle


    Target information

    Target ID GM-MP0759
    Target Name LRPAP1
    Gene ID 4043, 16976, 699677, 116565, 101087737, 479072, 504957, 100054064
    Gene Symbol and Synonyms A2MRAP,A2RAP,alpha-2-MRAP,HBP44,LRPAP1,MRAP,MYP23,RAP
    Uniprot Accession P30533
    Uniprot Entry Name AMRP_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000163956
    Target Classification Not Available

    This gene encodes a protein that interacts with the low density lipoprotein (LDL) receptor-related protein and facilitates its proper folding and localization by preventing the binding of ligands. Mutations in this gene have been identified in individuals with myopia 23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.