Human IGFBP7/AGM/FSTL2 ORF/cDNA clone-Lentivirus plasmid (NM_001553)

Cat. No.: pGMLP003505
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human IGFBP7/AGM/FSTL2 Lentiviral expression plasmid for IGFBP7 lentivirus packaging, IGFBP7 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf MSDS
pdf Datasheet
pdf Terms of Use
pdf Map
Target products collection

Go to IGFBP7/AGM products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $512.25
Shipping fee: Limited-time free


Product Description

Catalog ID pGMLP003505
Gene Name IGFBP7
Accession Number NM_001553
Gene ID 3490
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 849 bp
Gene Alias AGM,FSTL2,IBP-7,IGFBP-7,IGFBP-7v,IGFBPRP1,MAC25,PSF,RAMSVPS,TAF
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAGCGGCCGTCGCTGCGCGCCCTGCTCCTCGGCGCCGCTGGGCTGCTGCTCCTGCTCCTGCCCCTCTCCTCTTCCTCCTCTTCGGACACCTGCGGCCCCTGCGAGCCGGCCTCCTGCCCGCCCCTGCCCCCGCTGGGCTGCCTGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCTATGTGCGCCCGCGGCGAGGGCGAGCCGTGCGGGGGTGGCGGCGCCGGCAGGGGGTACTGCGCGCCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCCGGGGCAGCAGCCGGCGGTCCGGGTGTAAGCGGCGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGCGACGGCACCACCTACCCGAGCGGCTGCCAGCTGCGCGCCGCCAGCCAGAGGGCCGAGAGCCGCGGGGAGAAGGCCATCACCCAGGTCAGCAAGGGCACCTGCGAGCAAGGTCCTTCCATAGTGACGCCCCCCAAGGACATCTGGAATGTCACTGGTGCCCAGGTGTACTTGAGCTGTGAGGTCATCGGAATCCCGACACCTGTCCTCATCTGGAACAAGGTAAAAAGGGGTCACTATGGAGTTCAAAGGACAGAACTCCTGCCTGGTGACCGGGACAACCTGGCCATTCAGACCCGGGGTGGCCCAGAAAAGCATGAAGTAACTGGCTGGGTGCTGGTATCTCCTCTAAGTAAGGAAGATGCTGGAGAATATGAGTGCCATGCATCCAATTCCCAAGGACAGGCTTCAGCATCAGCAAAAATTACAGTGGTTGATGCCTTACATGAAATACCAGTGAAAAAAGGTGAAGGTGCCGAGCTATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T69271-Ab Anti-IBP7/ IGFBP7/ AGM functional antibody
    Target Antigen GM-Tg-g-T69271-Ag IGFBP7 protein
    Cytokine cks-Tg-g-GM-T69271 insulin-like growth factor binding protein 7 (IGFBP7) protein & antibody
    ORF Viral Vector pGMLP003505 Human IGFBP7 Lentivirus plasmid
    ORF Viral Vector pGMLV001817 Human IGFBP7 Lentivirus plasmid
    ORF Viral Vector pGMPC001481 Human IGFBP7 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP003505 Human IGFBP7 Lentivirus particle
    ORF Viral Vector vGMLV001817 Human IGFBP7 Lentivirus particle


    Target information

    Target ID GM-T69271
    Target Name IGFBP7
    Gene ID 3490, 29817, 693564, 289560, 101083263, 608559, 616368, 100033844
    Gene Symbol and Synonyms AGM,FSTL2,IBP-7,IGFBP-7,IGFBP-7v,IGFBP7,IGFBPRP1,MAC25,PSF,RAMSVPS,TAF
    Uniprot Accession Q16270
    Uniprot Entry Name IBP7_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Dent disease, Heart failure, Acute kidney failure
    Gene Ensembl ENSG00000163453
    Target Classification Not Available

    This gene encodes a member of the insulin-like growth factor (IGF)-binding protein (IGFBP) family. IGFBPs bind IGFs with high affinity, and regulate IGF availability in body fluids and tissues and modulate IGF binding to its receptors. This protein binds IGF-I and IGF-II with relatively low affinity, and belongs to a subfamily of low-affinity IGFBPs. It also stimulates prostacyclin production and cell adhesion. Alternatively spliced transcript variants encoding different isoforms have been described for this gene, and one variant has been associated with retinal arterial macroaneurysm (PMID:21835307). [provided by RefSeq, Dec 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.