Human PSMB5/LMPX/MB1 ORF/cDNA clone-Lentivirus plasmid (NM_002797)

Cat. No.: pGMLP003491
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PSMB5/LMPX/MB1 Lentiviral expression plasmid for PSMB5 lentivirus packaging, PSMB5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to PS beta-5/PSMB5/LMPX products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $498
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003491
Gene Name PSMB5
Accession Number NM_002797
Gene ID 5693
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 792 bp
Gene Alias LMPX,MB1,X
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGAACCAGCGCGGGTTTTTCGGACTTGGGGGTCGTGCAGATCTGCTGGATCTAGGTCCAGGGAGTCTCAGTGATGGTCTGAGCCTGGCCGCGCCAGGCTGGGGTGTCCCAGAAGAGCCAGGAATCGAAATGCTTCATGGAACAACCACCCTGGCCTTCAAGTTCCGCCATGGAGTCATAGTTGCAGCTGACTCCAGGGCTACAGCGGGTGCTTACATTGCCTCCCAGACGGTGAAGAAGGTGATAGAGATCAACCCATACCTGCTAGGCACCATGGCTGGGGGCGCAGCGGATTGCAGCTTCTGGGAACGGCTGTTGGCTCGGCAATGTCGAATCTATGAGCTTCGAAATAAGGAACGCATCTCTGTAGCAGCTGCCTCCAAACTGCTTGCCAACATGGTGTATCAGTACAAAGGCATGGGGCTGTCCATGGGCACCATGATCTGTGGCTGGGATAAGAGAGGCCCTGGCCTCTACTACGTGGACAGTGAAGGGAACCGGATTTCAGGGGCCACCTTCTCTGTAGGTTCTGGCTCTGTGTATGCATATGGGGTCATGGATCGGGGCTATTCCTATGACCTGGAAGTGGAGCAGGCCTATGATCTGGCCCGTCGAGCCATCTACCAAGCCACCTACAGAGATGCCTACTCAGGAGGTGCAGTCAACCTCTACCACGTGCGGGAGGATGGCTGGATCCGAGTCTCCAGTGACAATGTGGCTGATCTACATGAGAAGTATAGTGGCTCTACCCCCTGA
ORF Protein Sequence MALASVLERPLPVNQRGFFGLGGRADLLDLGPGSLSDGLSLAAPGWGVPEEPGIEMLHGTTTLAFKFRHGVIVAADSRATAGAYIASQTVKKVIEINPYLLGTMAGGAADCSFWERLLARQCRIYELRNKERISVAAASKLLANMVYQYKGMGLSMGTMICGWDKRGPGLYYVDSEGNRISGATFSVGSGSVYAYGVMDRGYSYDLEVEQAYDLARRAIYQATYRDAYSGGAVNLYHVREDGWIRVSSDNVADLHEKYSGSTP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T49031-Ab Anti-PS beta-5 monoclonal antibody
    Target Antigen GM-Tg-g-T49031-Ag PS beta-5/PSMB5 protein
    ORF Viral Vector pGMLP003491 Human PSMB5 Lentivirus plasmid
    ORF Viral Vector vGMLP003491 Human PSMB5 Lentivirus particle


    Target information

    Target ID GM-T49031
    Target Name PS beta-5
    Gene ID 5693, 19173, 677719, 29425, 101092368, 100855659, 534640, 100052570
    Gene Symbol and Synonyms LMPX,MB1,PSMB5
    Uniprot Accession P28074
    Uniprot Entry Name PSB5_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000100804
    Target Classification Not Available

    The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit in the proteasome. This catalytic subunit is not present in the immunoproteasome and is replaced by catalytic subunit 3i (proteasome beta 8 subunit). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.