Human ASIC3/ACCN3/DRASIC ORF/cDNA clone-Lentivirus plasmid (NM_004769)

Cat. No.: pGMLP003357
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human ASIC3/ACCN3/DRASIC Lentiviral expression plasmid for ASIC3 lentivirus packaging, ASIC3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to ASIC3/ACCN3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $794.76
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003357
Gene Name ASIC3
Accession Number NM_004769
Gene ID 9311
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1596 bp
Gene Alias ACCN3,DRASIC,SLNAC1,TNaC1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGCCCACCTCAGGCCCAGAGGAGGCCCGGCGGCCAGCCTCGGACATCCGCGTGTTCGCCAGCAACTGCTCGATGCACGGGCTGGGCCACGTCTTCGGGCCAGGCAGCCTGAGCCTGCGCCGGGGGATGTGGGCAGCGGCCGTGGTCCTGTCAGTGGCCACCTTCCTCTACCAGGTGGCTGAGAGGGTGCGCTACTACAGGGAGTTCCACCACCAGACTGCCCTGGATGAGCGAGAAAGCCACCGGCTCATCTTCCCGGCTGTCACCCTGTGCAACATCAACCCACTGCGCCGCTCGCGCCTAACGCCCAACGACCTGCACTGGGCTGGGTCTGCGCTGCTGGGCCTGGATCCCGCAGAGCACGCCGCCTTCCTGCGCGCCCTGGGCCGGCCCCCTGCACCGCCCGGCTTCATGCCCAGTCCCACCTTTGACATGGCGCAACTCTATGCCCGTGCTGGGCACTCCCTGGATGACATGCTGCTGGACTGTCGCTTCCGTGGCCAACCTTGTGGGCCTGAGAACTTCACCACGATCTTCACCCGGATGGGAAAGTGCTACACATTTAACTCTGGCGCTGATGGGGCAGAGCTGCTCACCACTACTAGGGGTGGCATGGGCAATGGGCTGGACATCATGCTGGACGTGCAGCAGGAGGAATATCTACCTGTGTGGAGGGACAATGAGGAGACCCCGTTTGAGGTGGGGATCCGAGTGCAGATCCACAGCCAGGAGGAGCCGCCCATCATCGATCAGCTGGGCTTGGGGGTGTCCCCGGGCTACCAGACCTTTGTTTCTTGCCAGCAGCAGCAGCTGAGCTTCCTGCCACCGCCCTGGGGCGATTGCAGTTCAGCATCTCTGAACCCCAACTATGAGCCAGAGCCCTCTGATCCCCTAGGCTCCCCCAGCCCCAGCCCCAGCCCTCCCTATACCCTTATGGGGTGTCGCCTGGCCTGCGAAACCCGCTACGTGGCTCGGAAGTGCGGCTGCCGAATGGTGTACATGCCAGGCGACGTGCCAGTGTGCAGCCCCCAGCAGTACAAGAACTGTGCCCACCCGGCCATAGATGCCATGCTTCGCAAGGACTCGTGCGCCTGCCCCAACCCGTGCGCCAGCACGCGCTACGCCAAGGAGCTCTCCATGGTGCGGATCCCGAGCCGCGCCGCCGCGCGCTTCCTGGCCCGGAAGCTCAACCGCAGCGAGGCCTACATCGCGGAGAACGTGCTGGCCCTGGACATCTTCTTTGAGGCCCTCAACTATGAGACCGTGGAGCAGAAGAAGGCCTATGAGATGTCAGAGCTGCTTGGTGACATTGGGGGCCAGATGGGGCTGTTCATCGGGGCCAGCCTGCTCACCATCCTCGAGATCCTAGACTACCTCTGTGAGGTGTTCCGAGACAAGGTCCTGGGATATTTCTGGAACCGACAGCACTCCCAAAGGCACTCCAGCACCAATCTGCTTCAGGAAGGGCTGGGCAGCCATCGAACCCAAGTTCCCCACCTCAGCCTGGGCCCCAGACCTCCCACCCCTCCCTGTGCCGTCACCAAGACTCTCTCCGCCTCCCACCGCACCTGCTACCTTGTCACACAGCTCTAG
ORF Protein Sequence MKPTSGPEEARRPASDIRVFASNCSMHGLGHVFGPGSLSLRRGMWAAAVVLSVATFLYQVAERVRYYREFHHQTALDERESHRLIFPAVTLCNINPLRRSRLTPNDLHWAGSALLGLDPAEHAAFLRALGRPPAPPGFMPSPTFDMAQLYARAGHSLDDMLLDCRFRGQPCGPENFTTIFTRMGKCYTFNSGADGAELLTTTRGGMGNGLDIMLDVQQEEYLPVWRDNEETPFEVGIRVQIHSQEEPPIIDQLGLGVSPGYQTFVSCQQQQLSFLPPPWGDCSSASLNPNYEPEPSDPLGSPSPSPSPPYTLMGCRLACETRYVARKCGCRMVYMPGDVPVCSPQQYKNCAHPAIDAMLRKDSCACPNPCASTRYAKELSMVRIPSRAAARFLARKLNRSEAYIAENVLALDIFFEALNYETVEQKKAYEMSELLGDIGGQMGLFIGASLLTILEILDYLCEVFRDKVLGYFWNRQHSQRHSSTNLLQEGLGSHRTQVPHLSLGPRPPTPPCAVTKTLSASHRTCYLVTQL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T95947-Ab Anti-ASIC3/ ACCN3/ DRASIC monoclonal antibody
    Target Antigen GM-Tg-g-T95947-Ag ASIC3 VLP (virus-like particle)
    ORF Viral Vector pGMLP003357 Human ASIC3 Lentivirus plasmid
    ORF Viral Vector vGMLP003357 Human ASIC3 Lentivirus particle


    Target information

    Target ID GM-T95947
    Target Name ASIC3
    Gene ID 9311, 171209, 714396, 286920, 101096970, 482801, 789132, 100063408
    Gene Symbol and Synonyms ACCN3,ASIC3,DRASIC,SLNAC1,TNaC1
    Uniprot Accession Q9UHC3
    Uniprot Entry Name ASIC3_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000213199
    Target Classification Ion Channel

    This gene encodes a member of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. The members of this family are amiloride-sensitive sodium channels that contain intracellular N and C termini, two hydrophobic transmembrane regions, and a large extracellular loop, which has many cysteine residues with conserved spacing. The member encoded by this gene is an acid sensor and may play an important role in the detection of lasting pH changes. In addition, a heteromeric association between this member and acid-sensing (proton-gated) ion channel 2 has been observed as proton-gated channels sensitive to gadolinium. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.