Human GFER/ALR/ ERV1 ORF/cDNA clone-Lentivirus plasmid (NM_005262)
Pre-made Human GFER/ALR/ ERV1 Lentiviral expression plasmid for GFER lentivirus packaging, GFER lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to GFER/ALR products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003164 | Human GFER Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003164 |
Gene Name | GFER |
Accession Number | NM_005262 |
Gene ID | 2671 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 618 bp |
Gene Alias | ALR, ERV1, HERV1, HPO, HPO1, HPO2, HSS |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCGGCGCCCGGCGAGCGGGGCCGCTTCCACGGCGGGAACCTCTTCTTCCTGCCGGGGGGCGCGCGCTCCGAGATGATGGACGACCTGGCGACCGACGCGCGGGGCCGGGGCGCGGGGCGGAGAGACGCGGCCGCCTCGGCCTCGACGCCAGCCCAGGCGCCGACCTCCGATTCTCCTGTCGCCGAGGACGCCTCCCGGAGGCGGCCGTGCCGGGCCTGCGTCGACTTCAAGACGTGGATGCGGACGCAGCAGAAGCGGGACACCAAGTTTAGGGAGGACTGCCCGCCGGATCGCGAGGAACTGGGCCGCCACAGCTGGGCTGTCCTCCACACCCTGGCCGCCTACTACCCCGACCTGCCCACCCCAGAACAGCAGCAAGACATGGCCCAGTTCATACATTTATTTTCTAAGTTTTACCCCTGTGAGGAGTGTGCTGAAGACCTAAGAAAAAGGCTGTGCAGGAACCACCCAGACACCCGCACCCGGGCATGCTTCACACAGTGGCTGTGCCACCTGCACAATGAAGTGAACCGCAAGCTGGGCAAGCCTGACTTCGACTGCTCAAAAGTGGATGAGCGCTGGCGCGACGGCTGGAAGGATGGCTCCTGTGACTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0943-Ab | Anti-ALR/ GFER/ ERV1 functional antibody |
Target Antigen | GM-Tg-g-SE0943-Ag | GFER protein |
ORF Viral Vector | pGMLV000509 | Human GFER Lentivirus plasmid |
ORF Viral Vector | pGMLP003164 | Human GFER Lentivirus plasmid |
ORF Viral Vector | vGMLV000509 | Human GFER Lentivirus particle |
ORF Viral Vector | vGMLP003164 | Human GFER Lentivirus particle |
Target information
Target ID | GM-SE0943 |
Target Name | GFER |
Gene ID | 2671, 11692, 694203, 27100, 101082968, 479885, 618423, 100065617 |
Gene Symbol and Synonyms | ALR,ERV1,GFER,HERV1,HPO,HPO1,HPO2,HSS,MMCHD,MPMCD |
Uniprot Accession | P55789 |
Uniprot Entry Name | ALR_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000127554 |
Target Classification | Not Available |
The hepatotrophic factor designated augmenter of liver regeneration (ALR) is thought to be one of the factors responsible for the extraordinary regenerative capacity of mammalian liver. It has also been called hepatic regenerative stimulation substance (HSS). The gene resides on chromosome 16 in the interval containing the locus for polycystic kidney disease (PKD1). The putative gene product is 42% similar to the scERV1 protein of yeast. The yeast scERV1 gene had been found to be essential for oxidative phosphorylation, the maintenance of mitochondrial genomes, and the cell division cycle. The human gene is both the structural and functional homolog of the yeast scERV1 gene. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.