Human TMEM100 ORF/cDNA clone-Lentivirus plasmid (NM_018286)

Pre-made Human TMEM100/ Lentiviral expression plasmid for TMEM100 lentivirus packaging, TMEM100 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to TMEM100/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003159 Human TMEM100 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003159
Gene Name TMEM100
Accession Number NM_018286
Gene ID 55273
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 405 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACTGAAGAGCCCATCAAGGAGATCCTGGGAGCCCCAAAGGCTCACATGGCAGCGACGATGGAGAAGAGCCCCAAGAGTGAAGTTGTGATCACCACAGTCCCTCTGGTCAGTGAGATTCAGTTGATGGCTGCTACAGGGGGTACCGAGCTCTCCTGCTACCGCTGCATCATCCCCTTTGCTGTGGTTGTCTTCATCGCCGGCATCGTGGTCACCGCGGTGGCTTACAGCTTCAATTCCCATGGGTCTATTATCTCCATCTTTGGCCTGGTTGTTCTGTCATCTGGACTTTTTTTACTAGCCTCCAGTGCCTTGTGCTGGAAAGTGAGACAAAGGAGCAAGAAAGCCAAGAGACGGGAGAGTCAAACAGCTCTCGTGGCAAATCAGAGAAGCTTGTTTGCTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1811-Ab Anti-TM100/ TMEM100 monoclonal antibody
    Target Antigen GM-Tg-g-MP1811-Ag TMEM100 VLP (virus-like particle)
    ORF Viral Vector pGMLV000407 Human TMEM100 Lentivirus plasmid
    ORF Viral Vector pGMLP003159 Human TMEM100 Lentivirus plasmid
    ORF Viral Vector vGMLV000407 Human TMEM100 Lentivirus particle
    ORF Viral Vector vGMLP003159 Human TMEM100 Lentivirus particle


    Target information

    Target ID GM-MP1811
    Target Name TMEM100
    Gene ID 55273, 67888, 707032, 497979, 101080590, 609661, 613987, 100056636
    Gene Symbol and Synonyms 1810057C19Rik,TMEM100
    Uniprot Accession Q9NV29
    Uniprot Entry Name TM100_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000166292
    Target Classification Not Available

    Involved in BMP signaling pathway. Located in several cellular components, including endoplasmic reticulum; perikaryon; and perinuclear region of cytoplasm. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.