Human PIP/GCDFP-15/ GCDFP15 ORF/cDNA clone-Lentivirus plasmid (NM_002652)
Pre-made Human PIP/GCDFP-15/ GCDFP15 Lentiviral expression plasmid for PIP lentivirus packaging, PIP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to PIP/GCDFP-15 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003151 | Human PIP Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003151 |
Gene Name | PIP |
Accession Number | NM_002652 |
Gene ID | 5304 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 441 bp |
Gene Alias | GCDFP-15, GCDFP15, GPIP4 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCGCTTGCTCCAGCTCCTGTTCAGGGCCAGCCCTGCCACCCTGCTCCTGGTTCTCTGCCTGCAGTTGGGGGCCAACAAAGCTCAGGACAACACTCGGAAGATCATAATAAAGAATTTTGACATTCCCAAGTCAGTACGTCCAAATGACGAAGTCACTGCAGTGCTTGCAGTTCAAACAGAATTGAAAGAATGCATGGTGGTTAAAACTTACCTCATTAGCAGCATCCCTCTACAAGGTGCATTTAACTATAAGTATACTGCCTGCCTATGTGACGACAATCCAAAAACCTTCTACTGGGACTTTTACACCAACAGAACTGTGCAAATTGCAGCCGTCGTTGATGTTATTCGGGAATTAGGCATCTGCCCTGATGATGCTGCTGTAATCCCCATCAAAAACAACCGGTTTTATACTATTGAAATCCTAAAGGTAGAATAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1187-Ab | Anti-PIP/ GCDFP-15/ GCDFP15 functional antibody |
Target Antigen | GM-Tg-g-SE1187-Ag | PIP protein |
ORF Viral Vector | pGMLV000278 | Human PIP Lentivirus plasmid |
ORF Viral Vector | pGMLP003151 | Human PIP Lentivirus plasmid |
ORF Viral Vector | vGMLV000278 | Human PIP Lentivirus particle |
ORF Viral Vector | vGMLP003151 | Human PIP Lentivirus particle |
Target information
Target ID | GM-SE1187 |
Target Name | PIP |
Gene ID | 5304, 705823, 105260406, 613853, 100629611 |
Gene Symbol and Synonyms | BRST-2,GCDFP-15,GCDFP15,GPIP4,PIP |
Uniprot Accession | P12273 |
Uniprot Entry Name | PIP_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Diabetic Nephropathy |
Gene Ensembl | ENSG00000159763 |
Target Classification | Not Available |
Enables IgG binding activity; aspartic-type endopeptidase activity; and identical protein binding activity. Involved in several processes, including detection of chemical stimulus involved in sensory perception of bitter taste; negative regulation of T cell apoptotic process; and proteolysis. Located in extracellular space and nucleus. [provided by Alliance of Genome Resources, Apr 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.