Human PIP/GCDFP-15/ GCDFP15 ORF/cDNA clone-Lentivirus plasmid (NM_002652)

Pre-made Human PIP/GCDFP-15/ GCDFP15 Lentiviral expression plasmid for PIP lentivirus packaging, PIP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to PIP/GCDFP-15 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003151 Human PIP Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003151
Gene Name PIP
Accession Number NM_002652
Gene ID 5304
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 441 bp
Gene Alias GCDFP-15, GCDFP15, GPIP4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCGCTTGCTCCAGCTCCTGTTCAGGGCCAGCCCTGCCACCCTGCTCCTGGTTCTCTGCCTGCAGTTGGGGGCCAACAAAGCTCAGGACAACACTCGGAAGATCATAATAAAGAATTTTGACATTCCCAAGTCAGTACGTCCAAATGACGAAGTCACTGCAGTGCTTGCAGTTCAAACAGAATTGAAAGAATGCATGGTGGTTAAAACTTACCTCATTAGCAGCATCCCTCTACAAGGTGCATTTAACTATAAGTATACTGCCTGCCTATGTGACGACAATCCAAAAACCTTCTACTGGGACTTTTACACCAACAGAACTGTGCAAATTGCAGCCGTCGTTGATGTTATTCGGGAATTAGGCATCTGCCCTGATGATGCTGCTGTAATCCCCATCAAAAACAACCGGTTTTATACTATTGAAATCCTAAAGGTAGAATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1187-Ab Anti-PIP/ GCDFP-15/ GCDFP15 functional antibody
    Target Antigen GM-Tg-g-SE1187-Ag PIP protein
    ORF Viral Vector pGMLV000278 Human PIP Lentivirus plasmid
    ORF Viral Vector pGMLP003151 Human PIP Lentivirus plasmid
    ORF Viral Vector vGMLV000278 Human PIP Lentivirus particle
    ORF Viral Vector vGMLP003151 Human PIP Lentivirus particle


    Target information

    Target ID GM-SE1187
    Target Name PIP
    Gene ID 5304, 705823, 105260406, 613853, 100629611
    Gene Symbol and Synonyms BRST-2,GCDFP-15,GCDFP15,GPIP4,PIP
    Uniprot Accession P12273
    Uniprot Entry Name PIP_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Diabetic Nephropathy
    Gene Ensembl ENSG00000159763
    Target Classification Not Available

    Enables IgG binding activity; aspartic-type endopeptidase activity; and identical protein binding activity. Involved in several processes, including detection of chemical stimulus involved in sensory perception of bitter taste; negative regulation of T cell apoptotic process; and proteolysis. Located in extracellular space and nucleus. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.