Human KCNJ2/ATFB9/HHBIRK1 ORF/cDNA clone-Lentivirus plasmid (NM_000891)

Cat. No.: pGMLP003142
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human KCNJ2/ATFB9/HHBIRK1 Lentiviral expression plasmid for KCNJ2 lentivirus packaging, KCNJ2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to KCNJ2/ATFB9 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $659.52
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003142
Gene Name KCNJ2
Accession Number NM_000891
Gene ID 3759
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1284 bp
Gene Alias ATFB9,HHBIRK1,HHIRK1,IRK1,KIR2.1,LQT7,SQT3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGCAGTGTGCGAACCAACCGCTACAGCATCGTCTCTTCAGAAGAAGACGGTATGAAGTTGGCCACCATGGCAGTTGCAAATGGCTTTGGGAACGGGAAGAGTAAAGTCCACACCCGACAACAGTGCAGGAGCCGCTTTGTGAAGAAAGATGGCCACTGTAATGTTCAGTTCATCAATGTGGGTGAGAAGGGGCAACGGTACCTCGCAGACATCTTCACCACGTGTGTGGACATTCGCTGGCGGTGGATGCTGGTTATCTTCTGCCTGGCTTTCGTCCTGTCATGGCTGTTTTTTGGCTGTGTGTTTTGGTTGATAGCTCTGCTCCATGGGGACCTGGATGCATCCAAAGAGGGCAAAGCTTGTGTGTCCGAGGTCAACAGCTTCACGGCTGCCTTCCTCTTCTCCATTGAGACCCAGACAACCATAGGCTATGGTTTCAGATGTGTCACGGATGAATGCCCAATTGCTGTTTTCATGGTGGTGTTCCAGTCAATCGTGGGCTGCATCATCGATGCTTTCATCATTGGCGCAGTCATGGCCAAGATGGCAAAGCCAAAGAAGAGAAACGAGACTCTTGTCTTCAGTCACAATGCCGTGATTGCCATGAGAGACGGCAAGCTGTGTTTGATGTGGCGAGTGGGCAATCTTCGGAAAAGCCACTTGGTGGAAGCTCATGTTCGAGCACAGCTCCTCAAATCCAGAATTACTTCTGAAGGGGAGTATATCCCTCTGGATCAAATAGACATCAATGTTGGGTTTGACAGTGGAATCGATCGTATATTTCTGGTGTCCCCAATCACTATAGTCCATGAAATAGATGAAGACAGTCCTTTATATGATTTGAGTAAACAGGACATTGACAACGCAGACTTTGAAATCGTGGTCATACTGGAAGGCATGGTGGAAGCCACTGCCATGACGACACAGTGCCGTAGCTCTTATCTAGCAAATGAAATCCTGTGGGGCCACCGCTATGAGCCTGTGCTCTTTGAAGAGAAGCACTACTACAAAGTGGACTATTCCAGGTTCCACAAAACTTACGAAGTCCCCAACACTCCCCTTTGTAGTGCCAGAGACTTAGCAGAAAAGAAATATATCCTCTCAAATGCAAATTCATTTTGCTATGAAAATGAAGTTGCCCTCACAAGCAAAGAGGAAGACGACAGTGAAAATGGAGTTCCAGAAAGCACTAGTACGGACACGCCCCCTGACATAGACCTTCACAACCAGGCAAGTGTACCTCTAGAGCCCAGGCCCTTACGGCGAGAGTCGGAGATATGA
ORF Protein Sequence MGSVRTNRYSIVSSEEDGMKLATMAVANGFGNGKSKVHTRQQCRSRFVKKDGHCNVQFINVGEKGQRYLADIFTTCVDIRWRWMLVIFCLAFVLSWLFFGCVFWLIALLHGDLDASKEGKACVSEVNSFTAAFLFSIETQTTIGYGFRCVTDECPIAVFMVVFQSIVGCIIDAFIIGAVMAKMAKPKKRNETLVFSHNAVIAMRDGKLCLMWRVGNLRKSHLVEAHVRAQLLKSRITSEGEYIPLDQIDINVGFDSGIDRIFLVSPITIVHEIDEDSPLYDLSKQDIDNADFEIVVILEGMVEATAMTTQCRSSYLANEILWGHRYEPVLFEEKHYYKVDYSRFHKTYEVPNTPLCSARDLAEKKYILSNANSFCYENEVALTSKEEDDSENGVPESTSTDTPPDIDLHNQASVPLEPRPLRRESEI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T74570-Ab Anti-KCNJ2/ ATFB9/ HHBIRK1 monoclonal antibody
    Target Antigen GM-Tg-g-T74570-Ag KCNJ2 VLP (virus-like particle)
    ORF Viral Vector pGMLP003142 Human KCNJ2 Lentivirus plasmid
    ORF Viral Vector pGMAD000757 Human KCNJ2 Adenovirus plasmid
    ORF Viral Vector pGMAD000836 Human KCNJ2 Adenovirus plasmid
    ORF Viral Vector vGMLP003142 Human KCNJ2 Lentivirus particle
    ORF Viral Vector vGMAD000757 Human KCNJ2 Adenovirus particle
    ORF Viral Vector vGMAD000836 Human KCNJ2 Adenovirus particle


    Target information

    Target ID GM-T74570
    Target Name KCNJ2
    Gene ID 3759, 16518, 574189, 29712, 101090306, 403717, 281883, 100052953
    Gene Symbol and Synonyms ATFB9,HHBIRK1,HHIRK1,IRK1,Kcnf1,KCNJ2,KIR2.1,LQT7,SQT3
    Uniprot Accession P63252
    Uniprot Entry Name KCNJ2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000123700
    Target Classification Ion Channel

    Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, probably participates in establishing action potential waveform and excitability of neuronal and muscle tissues. Mutations in this gene have been associated with Andersen syndrome, which is characterized by periodic paralysis, cardiac arrhythmias, and dysmorphic features. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.