Human ACKR3/CMKOR1/CXC-R7 ORF/cDNA clone-Lentivirus plasmid (NM_020311)

Cat. No.: pGMLP003139
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human ACKR3/CMKOR1/CXC-R7 Lentiviral expression plasmid for ACKR3 lentivirus packaging, ACKR3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf MSDS
pdf Datasheet
pdf Terms of Use
pdf Map
Target products collection

Go to ACKR3/CMKOR1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $604.92
Shipping fee: Limited-time free


Product Description

Catalog ID pGMLP003139
Gene Name ACKR3
Accession Number NM_020311
Gene ID 57007
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1089 bp
Gene Alias CMKOR1,CXC-R7,CXCR-7,CXCR7,GPR159,RDC-1,RDC1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGATCTGCATCTCTTCGACTACTCAGAGCCAGGGAACTTCTCGGACATCAGCTGGCCATGCAACAGCAGCGACTGCATCGTGGTGGACACGGTGATGTGTCCCAACATGCCCAACAAAAGCGTCCTGCTCTACACGCTCTCCTTCATTTACATTTTCATCTTCGTCATCGGCATGATTGCCAACTCCGTGGTGGTCTGGGTGAATATCCAGGCCAAGACCACAGGCTATGACACGCACTGCTACATCTTGAACCTGGCCATTGCCGACCTGTGGGTTGTCCTCACCATCCCAGTCTGGGTGGTCAGTCTCGTGCAGCACAACCAGTGGCCCATGGGCGAGCTCACGTGCAAAGTCACACACCTCATCTTCTCCATCAACCTCTTCGGCAGCATTTTCTTCCTCACGTGCATGAGCGTGGACCGCTACCTCTCCATCACCTACTTCACCAACACCCCCAGCAGCAGGAAGAAGATGGTACGCCGTGTCGTCTGCATCCTGGTGTGGCTGCTGGCCTTCTGCGTGTCTCTGCCTGACACCTACTACCTGAAGACCGTCACGTCTGCGTCCAACAATGAGACCTACTGCCGGTCCTTCTACCCCGAGCACAGCATCAAGGAGTGGCTGATCGGCATGGAGCTGGTCTCCGTTGTCTTGGGCTTTGCCGTTCCCTTCTCCATTATCGCTGTCTTCTACTTCCTGCTGGCCAGAGCCATCTCGGCGTCCAGTGACCAGGAGAAGCACAGCAGCCGGAAGATCATCTTCTCCTACGTGGTGGTCTTCCTTGTCTGCTGGCTGCCCTACCACGTGGCGGTGCTGCTGGACATCTTCTCCATCCTGCACTACATCCCTTTCACCTGCCGGCTGGAGCACGCCCTCTTCACGGCCCTGCATGTCACACAGTGCCTGTCGCTGGTGCACTGCTGCGTCAACCCTGTCCTCTACAGCTTCATCAATCGCAACTACAGGTACGAGCTGATGAAGGCCTTCATCTTCAAGTACTCGGCCAAAACAGGGCTCACCAAGCTCATCGATGCCTCCAGAGTCTCAGAGACGGAGTACTCTGCCTTGGAGCAGAGCACCAAATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T10491-Ab Anti-ACKR3/ CMKOR1/ CXC-R7 monoclonal antibody
    Target Antigen GM-Tg-g-T10491-Ag ACKR3 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T10491 chemokine (C-X-C motif) receptor 7 (CXCR7) protein & antibody
    ORF Viral Vector pGMLP003139 Human ACKR3 Lentivirus plasmid
    ORF Viral Vector pGMLV000082 Human ACKR3 Lentivirus plasmid
    ORF Viral Vector pGMLV000566 Human ACKR3 Lentivirus plasmid
    ORF Viral Vector pGMAP000125 Human CXCR7 Adenovirus plasmid
    ORF Viral Vector pGMAP000127 Human CXCR7 Adenovirus plasmid
    ORF Viral Vector vGMLP003139 Human ACKR3 Lentivirus particle
    ORF Viral Vector vGMLV000082 Human ACKR3 Lentivirus particle
    ORF Viral Vector vGMLV000566 Human ACKR3 Lentivirus particle
    ORF Viral Vector vGMAP000125 Human CXCR7 Adenovirus particle
    ORF Viral Vector vGMAP000127 Human CXCR7 Adenovirus particle


    Target information

    Target ID GM-T10491
    Target Name ACKR3
    Gene ID 57007, 12778, 694428, 84348, 101080817, 403964, 509585, 100057501
    Gene Symbol and Synonyms ACKR3,CMKOR1,CXC-R7,CXCR-7,CXCR7,GPR159,RDC-1,RDC1
    Uniprot Accession P25106
    Uniprot Entry Name ACKR3_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000144476
    Target Classification Checkpoint-Immuno Oncology, GPCR, Tumor-associated antigen (TAA)

    This gene encodes a member of the G-protein coupled receptor family. Although this protein was earlier thought to be a receptor for vasoactive intestinal peptide (VIP), it is now considered to be an orphan receptor, in that its endogenous ligand has not been identified. The protein is also a coreceptor for human immunodeficiency viruses (HIV). Translocations involving this gene and HMGA2 on chromosome 12 have been observed in lipomas. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.