Human IGFBP4/BP-4/ HT29-IGFBP ORF/cDNA clone-Lentivirus plasmid (NM_001552)
Pre-made Human IGFBP4/BP-4/ HT29-IGFBP Lentiviral expression plasmid for IGFBP4 lentivirus packaging, IGFBP4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to IGFBP4/BP-4 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003022 | Human IGFBP4 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003022 |
Gene Name | IGFBP4 |
Accession Number | NM_001552 |
Gene ID | 3487 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 777 bp |
Gene Alias | BP-4, HT29-IGFBP, IBP4, IGFBP-4 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCTGCCCCTCTGCCTCGTGGCCGCCCTGCTGCTGGCCGCCGGGCCCGGGCCGAGCCTGGGCGACGAAGCCATCCACTGCCCGCCCTGCTCCGAGGAGAAGCTGGCGCGCTGCCGCCCCCCCGTGGGCTGCGAGGAGCTGGTGCGAGAGCCGGGCTGCGGCTGTTGCGCCACTTGCGCCCTGGGCTTGGGGATGCCCTGCGGGGTGTACACCCCCCGTTGCGGCTCGGGCCTGCGCTGCTACCCGCCCCGAGGGGTGGAGAAGCCCCTGCACACACTGATGCACGGGCAAGGCGTGTGCATGGAGCTGGCGGAGATCGAGGCCATCCAGGAAAGCCTGCAGCCCTCTGACAAGGACGAGGGTGACCACCCCAACAACAGCTTCAGCCCCTGTAGCGCCCATGACCGCAGGTGCCTGCAGAAGCACTTCGCCAAAATTCGAGACCGGAGCACCAGTGGGGGCAAGATGAAGGTCAATGGGGCGCCCCGGGAGGATGCCCGGCCTGTGCCCCAGGGCTCCTGCCAGAGCGAGCTGCACCGGGCGCTGGAGCGGCTGGCCGCTTCACAGAGCCGCACCCACGAGGACCTCTACATCATCCCCATCCCCAACTGCGACCGCAACGGCAACTTCCACCCCAAGCAGTGTCACCCAGCTCTGGATGGGCAGCGTGGCAAGTGCTGGTGTGTGGACCGGAAGACGGGGGTGAAGCTTCCGGGGGGCCTGGAGCCAAAGGGGGAGCTGGACTGCCACCAGCTGGCTGACAGCTTTCGAGAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0986-Ab | Anti-IBP4/ IGFBP4/ BP-4 functional antibody |
Target Antigen | GM-Tg-g-SE0986-Ag | IGFBP4 protein |
Cytokine | cks-Tg-g-GM-SE0986 | insulin-like growth factor binding protein 4 (IGFBP4) protein & antibody |
ORF Viral Vector | pGMLP003022 | Human IGFBP4 Lentivirus plasmid |
ORF Viral Vector | vGMLP003022 | Human IGFBP4 Lentivirus particle |
Target information
Target ID | GM-SE0986 |
Target Name | IGFBP4 |
Gene ID | 3487, 16010, 700963, 360622, 101082792, 608158, 282262, 100034062 |
Gene Symbol and Synonyms | BP-4,Deb2,HT29-IGFBP,IBP-4,IBP4,IGF-BP4,IGFBP-4,IGFBP4 |
Uniprot Accession | P22692 |
Uniprot Entry Name | IBP4_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Cytokine Target |
Disease | Pancreas Cancer, Dent disease |
Gene Ensembl | ENSG00000141753 |
Target Classification | Not Available |
This gene is a member of the insulin-like growth factor binding protein (IGFBP) family and encodes a protein with an IGFBP domain and a thyroglobulin type-I domain. The protein binds both insulin-like growth factors (IGFs) I and II and circulates in the plasma in both glycosylated and non-glycosylated forms. Binding of this protein prolongs the half-life of the IGFs and alters their interaction with cell surface receptors. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.