Human IGFBP4/BP-4/ HT29-IGFBP ORF/cDNA clone-Lentivirus plasmid (NM_001552)

Pre-made Human IGFBP4/BP-4/ HT29-IGFBP Lentiviral expression plasmid for IGFBP4 lentivirus packaging, IGFBP4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to IGFBP4/BP-4 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003022 Human IGFBP4 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003022
Gene Name IGFBP4
Accession Number NM_001552
Gene ID 3487
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 777 bp
Gene Alias BP-4, HT29-IGFBP, IBP4, IGFBP-4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCTGCCCCTCTGCCTCGTGGCCGCCCTGCTGCTGGCCGCCGGGCCCGGGCCGAGCCTGGGCGACGAAGCCATCCACTGCCCGCCCTGCTCCGAGGAGAAGCTGGCGCGCTGCCGCCCCCCCGTGGGCTGCGAGGAGCTGGTGCGAGAGCCGGGCTGCGGCTGTTGCGCCACTTGCGCCCTGGGCTTGGGGATGCCCTGCGGGGTGTACACCCCCCGTTGCGGCTCGGGCCTGCGCTGCTACCCGCCCCGAGGGGTGGAGAAGCCCCTGCACACACTGATGCACGGGCAAGGCGTGTGCATGGAGCTGGCGGAGATCGAGGCCATCCAGGAAAGCCTGCAGCCCTCTGACAAGGACGAGGGTGACCACCCCAACAACAGCTTCAGCCCCTGTAGCGCCCATGACCGCAGGTGCCTGCAGAAGCACTTCGCCAAAATTCGAGACCGGAGCACCAGTGGGGGCAAGATGAAGGTCAATGGGGCGCCCCGGGAGGATGCCCGGCCTGTGCCCCAGGGCTCCTGCCAGAGCGAGCTGCACCGGGCGCTGGAGCGGCTGGCCGCTTCACAGAGCCGCACCCACGAGGACCTCTACATCATCCCCATCCCCAACTGCGACCGCAACGGCAACTTCCACCCCAAGCAGTGTCACCCAGCTCTGGATGGGCAGCGTGGCAAGTGCTGGTGTGTGGACCGGAAGACGGGGGTGAAGCTTCCGGGGGGCCTGGAGCCAAAGGGGGAGCTGGACTGCCACCAGCTGGCTGACAGCTTTCGAGAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0986-Ab Anti-IBP4/ IGFBP4/ BP-4 functional antibody
    Target Antigen GM-Tg-g-SE0986-Ag IGFBP4 protein
    Cytokine cks-Tg-g-GM-SE0986 insulin-like growth factor binding protein 4 (IGFBP4) protein & antibody
    ORF Viral Vector pGMLP003022 Human IGFBP4 Lentivirus plasmid
    ORF Viral Vector vGMLP003022 Human IGFBP4 Lentivirus particle


    Target information

    Target ID GM-SE0986
    Target Name IGFBP4
    Gene ID 3487, 16010, 700963, 360622, 101082792, 608158, 282262, 100034062
    Gene Symbol and Synonyms BP-4,Deb2,HT29-IGFBP,IBP-4,IBP4,IGF-BP4,IGFBP-4,IGFBP4
    Uniprot Accession P22692
    Uniprot Entry Name IBP4_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Pancreas Cancer, Dent disease
    Gene Ensembl ENSG00000141753
    Target Classification Not Available

    This gene is a member of the insulin-like growth factor binding protein (IGFBP) family and encodes a protein with an IGFBP domain and a thyroglobulin type-I domain. The protein binds both insulin-like growth factors (IGFs) I and II and circulates in the plasma in both glycosylated and non-glycosylated forms. Binding of this protein prolongs the half-life of the IGFs and alters their interaction with cell surface receptors. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.