Human GDF2/BMP-9/BMP9 ORF/cDNA clone-Lentivirus plasmid (NM_016204)

Cat. No.: pGMLP002764
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GDF2/BMP-9/BMP9 Lentiviral expression plasmid for GDF2 lentivirus packaging, GDF2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf MSDS
pdf Datasheet
pdf Terms of Use
pdf Map
Target products collection

Go to GDF2/BMP-9 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $661.2
Shipping fee: Limited-time free


Product Description

Catalog ID pGMLP002764
Gene Name GDF2
Accession Number NM_016204
Gene ID 2658
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1290 bp
Gene Alias BMP-9,BMP9,HHT5
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTGTCCTGGGGCACTGTGGGTGGCCCTGCCCCTGCTGTCCCTGCTGGCTGGCTCCCTACAGGGGAAGCCACTGCAGAGCTGGGGACGAGGGTCTGCTGGGGGAAACGCCCACAGCCCACTGGGGGTGCCTGGAGGTGGGCTGCCTGAGCACACCTTCAACCTGAAGATGTTTCTGGAGAACGTGAAGGTGGATTTCCTGCGCAGCCTTAACCTGAGTGGGGTCCCTTCGCAGGACAAAACCAGGGTGGAGCCGCCGCAGTACATGATTGACCTGTACAACAGGTACACGTCCGATAAGTCGACTACGCCAGCGTCCAACATTGTGCGGAGCTTCAGCATGGAAGATGCCATCTCCATAACTGCCACAGAGGACTTCCCCTTCCAGAAGCACATCTTGCTCTTCAACATCTCCATTCCTAGGCATGAGCAGATCACCAGAGCTGAGCTCCGACTCTATGTCTCCTGTCAAAATCACGTGGACCCCTCTCATGACCTGAAAGGAAGCGTGGTCATTTATGATGTTCTGGATGGAACAGATGCCTGGGATAGTGCTACAGAGACCAAGACCTTCCTGGTGTCCCAGGACATTCAGGATGAGGGCTGGGAGACCTTGGAAGTGTCCAGCGCCGTGAAGCGCTGGGTCCGGTCCGACTCCACCAAGAGCAAAAATAAGCTGGAAGTGACTGTGGAGAGCCACAGGAAGGGCTGCGACACGCTGGACATCAGTGTCCCCCCAGGTTCCAGAAACCTGCCCTTCTTTGTTGTCTTCTCCAATGACCACAGCAGTGGGACCAAGGAGACCAGGCTGGAGCTGAGGGAGATGATCAGCCATGAACAAGAGAGCGTGCTCAAGAAGCTGTCCAAGGACGGCTCCACAGAGGCAGGTGAGAGCAGTCACGAGGAGGACACGGATGGCCACGTGGCTGCGGGGTCGACTTTAGCCAGGCGGAAAAGGAGCGCCGGGGCTGGCAGCCACTGTCAAAAGACCTCCCTGCGGGTAAACTTCGAGGACATCGGCTGGGACAGCTGGATCATTGCACCCAAGGAGTATGAAGCCTACGAGTGTAAGGGCGGCTGCTTCTTCCCCTTGGCTGACGATGTGACGCCGACGAAACACGCTATCGTGCAGACCCTGGTGCATCTCAAGTTCCCCACAAAGGTGGGCAAGGCCTGCTGTGTGCCCACCAAACTGAGCCCCATCTCCGTCCTCTACAAGGATGACATGGGGGTGCCCACCCTCAAGTACCATTACGAGGGCATGAGCGTGGCAGAGTGTGGGTGCAGGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T27611-Ab Anti-GDF2/ BMP-9/ BMP9 functional antibody
    Target Antigen GM-Tg-g-T27611-Ag GDF2 protein
    Cytokine cks-Tg-g-GM-T27611 growth differentiation factor 2 (GDF2) protein & antibody
    ORF Viral Vector pGMLP002764 Human GDF2 Lentivirus plasmid
    ORF Viral Vector vGMLP002764 Human GDF2 Lentivirus particle


    Target information

    Target ID GM-T27611
    Target Name GDF2
    Gene ID 2658, 12165, 711516, 290921, 101087270, 611149, 540384, 100051984
    Gene Symbol and Synonyms BMP-9,BMP9,GDF2,HHT5
    Uniprot Accession Q9UK05
    Uniprot Entry Name GDF2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000263761
    Target Classification Not Available

    This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates cartilage and bone development, angiogenesis and differentiation of cholinergic central nervous system neurons. Mutations in this gene are associated with hereditary hemorrhagic telangiectasia. [provided by RefSeq, Jul 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.