Human PGLYRP3/PGLYRPIalpha/PGRP-Ialpha ORF/cDNA clone-Lentivirus plasmid (NM_052891)

Cat. No.: pGMLP002598
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PGLYRP3/PGLYRPIalpha/PGRP-Ialpha Lentiviral expression plasmid for PGLYRP3 lentivirus packaging, PGLYRP3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to PGLYRP3/PGLYRPIalpha products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $587.28
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002598
Gene Name PGLYRP3
Accession Number NM_052891
Gene ID 114771
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1026 bp
Gene Alias PGLYRPIalpha,PGRP-Ialpha,PGRPIA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGGACGCTGCCATGGCTTCTTGCCTTCTTCATTCTGGGTCTCCAGGCTTGGGATACTCCCACCATCGTCTCCCGCAAGGAGTGGGGGGCAAGACCGCTCGCCTGCAGGGCCCTGCTGACCCTGCCTGTGGCCTACATCATCACAGACCAGCTCCCAGGGATGCAGTGCCAGCAGCAGAGCGTTTGCAGCCAGATGCTGCGGGGGTTGCAGTCCCATTCCGTCTACACCATAGGCTGGTGCGACGTGGCGTACAACTTCCTGGTTGGGGATGATGGCAGGGTGTATGAAGGTGTTGGCTGGAACATCCAAGGCTTGCACACCCAGGGCTACAACAACATTTCCCTGGGCATCGCCTTCTTTGGCAATAAGATAGGCAGCAGTCCCAGCCCTGCTGCCTTATCAGCTGCAGAGGGTCTGATCTCCTATGCCATCCAGAAGGGTCACCTGTCGCCCAGGTATATTCAGCCACTTCTTCTGAAAGAAGAGACCTGCCTGGACCCTCAACATCCAGTGATGCCCAGGAAGGTTTGCCCCAACATCATCAAACGATCTGCTTGGGAAGCCAGAGAGACACACTGCCCTAAAATGAACCTCCCAGCCAAATATGTCATCATCATCCACACCGCTGGCACAAGCTGCACTGTATCCACAGACTGCCAGACTGTCGTCCGAAACATACAGTCCTTTCACATGGACACACGGAACTTTTGTGACATTGGATATCACTTCCTGGTGGGCCAGGATGGTGGCGTGTATGAAGGGGTTGGATGGCACATCCAAGGCTCTCACACTTATGGATTCAACGATATTGCCCTAGGAATTGCCTTCATCGGCTACTTTGTAGAAAAGCCTCCAAATGCTGCAGCGCTGGAGGCGGCCCAGGACCTGATCCAGTGTGCCGTGGTTGAGGGGTACCTGACTCCAAACTACCTGCTGATGGGCCACAGTGACGTGGTCAACATCCTGTCCCCTGGGCAGGCTTTGTATAACATCATCAGCACCTGGCCTCATTTCAAGCACTGA
ORF Protein Sequence MGTLPWLLAFFILGLQAWDTPTIVSRKEWGARPLACRALLTLPVAYIITDQLPGMQCQQQSVCSQMLRGLQSHSVYTIGWCDVAYNFLVGDDGRVYEGVGWNIQGLHTQGYNNISLGIAFFGNKIGSSPSPAALSAAEGLISYAIQKGHLSPRYIQPLLLKEETCLDPQHPVMPRKVCPNIIKRSAWEARETHCPKMNLPAKYVIIIHTAGTSCTVSTDCQTVVRNIQSFHMDTRNFCDIGYHFLVGQDGGVYEGVGWHIQGSHTYGFNDIALGIAFIGYFVEKPPNAAALEAAQDLIQCAVVEGYLTPNYLLMGHSDVVNILSPGQALYNIISTWPHFKH

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1183-Ab Anti-PGRP3/ PGLYRP3/ PGLYRPIalpha functional antibody
    Target Antigen GM-Tg-g-SE1183-Ag PGLYRP3 protein
    ORF Viral Vector pGMLP002598 Human PGLYRP3 Lentivirus plasmid
    ORF Viral Vector vGMLP002598 Human PGLYRP3 Lentivirus particle


    Target information

    Target ID GM-SE1183
    Target Name PGLYRP3
    Gene ID 114771, 714583, 101089129, 100061531
    Gene Symbol and Synonyms PGLYRP3,PGLYRPIalpha,PGRP-Ialpha,PGRPIA
    Uniprot Accession Q96LB9
    Uniprot Entry Name PGRP3_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000159527
    Target Classification Not Available

    This gene encodes a peptidoglycan recognition protein, which belongs to the N-acetylmuramoyl-L-alanine amidase 2 family. These proteins are part of the innate immune system and recognize peptidoglycan, a ubiquitous component of bacterial cell walls. This antimicrobial protein binds to murein peptidoglycans of Gram-positive bacteria. [provided by RefSeq, Oct 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.