Human CXCR6/BONZO/CD186 ORF/cDNA clone-Lentivirus plasmid (NM_006564)

SKU: pGMLP002468
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CXCR6/BONZO/CD186 Lentiviral expression plasmid for CXCR6 lentivirus packaging, CXCR6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CXCR6/BONZO products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $588.12
Shipping fee: Limited-time free


Product Description

Catalog ID pGMLP002468
Gene Name CXCR6
Accession Number NM_006564
Gene ID 10663
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1029 bp
Gene Alias BONZO,CD186,STRL33,TYMSTR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCAGAGCATGATTACCATGAAGACTATGGGTTCAGCAGTTTCAATGACAGCAGCCAGGAGGAGCATCAAGACTTCCTGCAGTTCAGCAAGGTCTTTCTGCCCTGCATGTACCTGGTGGTGTTTGTCTGTGGTCTGGTGGGGAACTCTCTGGTGCTGGTCATATCCATCTTCTACCATAAGTTGCAGAGCCTGACGGATGTGTTCCTGGTGAACCTACCCCTGGCTGACCTGGTGTTTGTCTGCACTCTGCCCTTCTGGGCCTATGCAGGCATCCATGAATGGGTGTTTGGCCAGGTCATGTGCAAGAGCCTACTGGGCATCTACACTATTAACTTCTACACGTCCATGCTCATCCTCACCTGCATCACTGTGGATCGTTTCATTGTAGTGGTTAAGGCCACCAAGGCCTACAACCAGCAAGCCAAGAGGATGACCTGGGGCAAGGTCACCAGCTTGCTCATCTGGGTGATATCCCTGCTGGTTTCCTTGCCCCAAATTATCTATGGCAATGTCTTTAATCTCGACAAGCTCATATGTGGTTACCATGACGAGGCAATTTCCACTGTGGTTCTTGCCACCCAGATGACACTGGGGTTCTTCTTGCCACTGCTCACCATGATTGTCTGCTATTCAGTCATAATCAAAACACTGCTTCATGCTGGAGGCTTCCAGAAGCACAGATCTCTAAAGATCATCTTCCTGGTGATGGCTGTGTTCCTGCTGACCCAGATGCCCTTCAACCTCATGAAGTTCATCCGCAGCACACACTGGGAATACTATGCCATGACCAGCTTTCACTACACCATCATGGTGACAGAGGCCATCGCATACCTGAGGGCCTGCCTTAACCCTGTGCTCTATGCCTTTGTCAGCCTGAAGTTTCGAAAGAACTTCTGGAAACTTGTGAAGGACATTGGTTGCCTCCCTTACCTTGGGGTCTCACATCAATGGAAATCTTCTGAGGACAATTCCAAGACTTTTTCTGCCTCCCACAATGTGGAGGCCACCAGCATGTTCCAGTTATAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T53975-Ab Anti-CXCR6/ BONZO/ CD186 monoclonal antibody
    Target Antigen GM-Tg-g-T53975-Ag CXCR6 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T53975 chemokine (C-X-C motif) receptor 6 (CXCR6) protein & antibody
    ORF Viral Vector pGMLP002468 Human CXCR6 Lentivirus plasmid
    ORF Viral Vector pGMAAV000925 Human CXCR6 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector vGMLP002468 Human CXCR6 Lentivirus particle
    ORF Viral Vector vGMAAV000925 Human CXCR6 Adeno-associate virus(AAV) particle


    Target information

    Target ID GM-T53975
    Target Name CXCR6
    Gene ID 10663, 80901, 713829, 100124593, 101083494, 608840, 506807, 100630558
    Gene Symbol and Synonyms BONZO,CD186,CDw186,CXCR6,STRL33,TYMSTR
    Uniprot Accession O00574
    Uniprot Entry Name CXCR6_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000172215
    Target Classification GPCR

    The protein encoded by this gene is a G protein-coupled receptor with seven transmembrane domains that belongs to the CXC chemokine receptor family. This family also includes CXCR1, CXCR2, CXCR3, CXCR4, CXCR5, and CXCR7. This gene, which maps to the chemokine receptor gene cluster, is expressed in several T lymphocyte subsets and bone marrow stromal cells. The encoded protein and its exclusive ligand, chemokine ligand 16 (CCL16), are part of a signalling pathway that regulates T lymphocyte migration to various peripheral tissues (the liver, spleen red pulp, intestine, lungs, and skin) and promotes cell-cell interaction with dendritic cells and fibroblastic reticular cells. CXCR6/CCL16 also controls the localization of resident memory T lymphocytes to different compartments of the lung and maintains airway resident memory T lymphocytes, which are an important first line of defense against respiratory pathogens. The encoded protein serves as an entry coreceptor used by HIV-1 and SIV to enter target cells, in conjunction with CD4. [provided by RefSeq, Aug 2020]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.