- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human CXCR6/BONZO/ CD186 ORF/cDNA clone-Lentivirus plasmid (NM_006564)
Pre-made Human CXCR6/BONZO/ CD186 Lentiviral expression plasmid for CXCR6 lentivirus packaging, CXCR6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to CXCR6/BONZO products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
|---|---|---|---|
| pGMLP002468 | Human CXCR6 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
| GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
| High Quality (HQ) Grade | |||
| Seed | 5ug |
Product Description
| Catalog ID | pGMLP002468 |
| Gene Name | CXCR6 |
| Accession Number | NM_006564 |
| Gene ID | 10663 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 1029 bp |
| Gene Alias | BONZO, CD186, STRL33, TYMSTR |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGGCAGAGCATGATTACCATGAAGACTATGGGTTCAGCAGTTTCAATGACAGCAGCCAGGAGGAGCATCAAGACTTCCTGCAGTTCAGCAAGGTCTTTCTGCCCTGCATGTACCTGGTGGTGTTTGTCTGTGGTCTGGTGGGGAACTCTCTGGTGCTGGTCATATCCATCTTCTACCATAAGTTGCAGAGCCTGACGGATGTGTTCCTGGTGAACCTACCCCTGGCTGACCTGGTGTTTGTCTGCACTCTGCCCTTCTGGGCCTATGCAGGCATCCATGAATGGGTGTTTGGCCAGGTCATGTGCAAGAGCCTACTGGGCATCTACACTATTAACTTCTACACGTCCATGCTCATCCTCACCTGCATCACTGTGGATCGTTTCATTGTAGTGGTTAAGGCCACCAAGGCCTACAACCAGCAAGCCAAGAGGATGACCTGGGGCAAGGTCACCAGCTTGCTCATCTGGGTGATATCCCTGCTGGTTTCCTTGCCCCAAATTATCTATGGCAATGTCTTTAATCTCGACAAGCTCATATGTGGTTACCATGACGAGGCAATTTCCACTGTGGTTCTTGCCACCCAGATGACACTGGGGTTCTTCTTGCCACTGCTCACCATGATTGTCTGCTATTCAGTCATAATCAAAACACTGCTTCATGCTGGAGGCTTCCAGAAGCACAGATCTCTAAAGATCATCTTCCTGGTGATGGCTGTGTTCCTGCTGACCCAGATGCCCTTCAACCTCATGAAGTTCATCCGCAGCACACACTGGGAATACTATGCCATGACCAGCTTTCACTACACCATCATGGTGACAGAGGCCATCGCATACCTGAGGGCCTGCCTTAACCCTGTGCTCTATGCCTTTGTCAGCCTGAAGTTTCGAAAGAACTTCTGGAAACTTGTGAAGGACATTGGTTGCCTCCCTTACCTTGGGGTCTCACATCAATGGAAATCTTCTGAGGACAATTCCAAGACTTTTTCTGCCTCCCACAATGTGGAGGCCACCAGCATGTTCCAGTTATAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T53975-Ab | Anti-CXCR6/ BONZO/ CD186 monoclonal antibody |
| Target Antigen | GM-Tg-g-T53975-Ag | CXCR6 VLP (virus-like particle) |
| Cytokine | cks-Tg-g-GM-T53975 | chemokine (C-X-C motif) receptor 6 (CXCR6) protein & antibody |
| ORF Viral Vector | pGMAAV000925 | Human CXCR6 Adeno-associate virus(AAV) plasmid |
| ORF Viral Vector | pGMLP002468 | Human CXCR6 Lentivirus plasmid |
| ORF Viral Vector | vGMAAV000925 | Human CXCR6 Adeno-associate virus(AAV) particle |
| ORF Viral Vector | vGMLP002468 | Human CXCR6 Lentivirus particle |
Target information
| Target ID | GM-T53975 |
| Target Name | CXCR6 |
| Gene ID | 10663, 80901, 713829, 100124593, 101083494, 608840, 506807, 100630558 |
| Gene Symbol and Synonyms | BONZO,CD186,CDw186,CXCR6,STRL33,TYMSTR |
| Uniprot Accession | O00574 |
| Uniprot Entry Name | CXCR6_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target, Cytokine Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000172215 |
| Target Classification | GPCR |
The protein encoded by this gene is a G protein-coupled receptor with seven transmembrane domains that belongs to the CXC chemokine receptor family. This family also includes CXCR1, CXCR2, CXCR3, CXCR4, CXCR5, and CXCR7. This gene, which maps to the chemokine receptor gene cluster, is expressed in several T lymphocyte subsets and bone marrow stromal cells. The encoded protein and its exclusive ligand, chemokine ligand 16 (CCL16), are part of a signalling pathway that regulates T lymphocyte migration to various peripheral tissues (the liver, spleen red pulp, intestine, lungs, and skin) and promotes cell-cell interaction with dendritic cells and fibroblastic reticular cells. CXCR6/CCL16 also controls the localization of resident memory T lymphocytes to different compartments of the lung and maintains airway resident memory T lymphocytes, which are an important first line of defense against respiratory pathogens. The encoded protein serves as an entry coreceptor used by HIV-1 and SIV to enter target cells, in conjunction with CD4. [provided by RefSeq, Aug 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
