Human PLA2G1B/PLA2/PLA2A ORF/cDNA clone-Lentivirus plasmid (NM_000928)

SKU: pGMLP002399
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PLA2G1B/PLA2/PLA2A Lentiviral expression plasmid for PLA2G1B lentivirus packaging, PLA2G1B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf MSDS
pdf Datasheet
pdf Terms of Use
pdf Map
Target products collection

Go to PLA2G1B/PLA2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free


Product Description

Catalog ID pGMLP002399
Gene Name PLA2G1B
Accession Number NM_000928
Gene ID 5319
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 447 bp
Gene Alias PLA2,PLA2A,PPLA2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAACTCCTTGTGCTAGCTGTGCTGCTCACAGTGGCCGCCGCCGACAGCGGCATCAGCCCTCGGGCCGTGTGGCAGTTCCGCAAAATGATCAAGTGCGTGATCCCGGGGAGTGACCCCTTCTTGGAATACAACAACTACGGCTGCTACTGTGGCTTGGGGGGCTCAGGCACCCCCGTGGATGAACTGGACAAGTGCTGCCAGACACATGACAACTGCTATGACCAGGCCAAGAAGCTGGACAGCTGTAAATTTCTGCTGGACAACCCGTACACCCACACCTATTCATACTCGTGCTCTGGCTCGGCAATCACCTGTAGCAGCAAAAACAAAGAGTGTGAGGCCTTCATTTGCAACTGCGACCGCAACGCTGCCATCTGCTTTTCAAAAGCTCCATATAACAAGGCACACAAGAACCTGGACACCAAGAAGTATTGTCAGAGTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T31479-Ab Anti-PA21B/ PLA2G1B/ PLA2 functional antibody
    Target Antigen GM-Tg-g-T31479-Ag PLA2G1B protein
    ORF Viral Vector pGMLP002399 Human PLA2G1B Lentivirus plasmid
    ORF Viral Vector vGMLP002399 Human PLA2G1B Lentivirus particle


    Target information

    Target ID GM-T31479
    Target Name PLA2G1B
    Gene ID 5319, 18778, 696712, 29526, 101095522, 404011, 282457, 100050467
    Gene Symbol and Synonyms PLA2,PLA2A,PLA2G1B,PPLA2,sPLA2IB
    Uniprot Accession P04054
    Uniprot Entry Name PA21B_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000170890
    Target Classification Not Available

    This gene encodes a secreted member of the phospholipase A2 (PLA2) class of enzymes, which is produced by the pancreatic acinar cells. The encoded calcium-dependent enzyme catalyzes the hydrolysis of the sn-2 position of membrane glycerophospholipids to release arachidonic acid (AA) and lysophospholipids. AA is subsequently converted by downstream metabolic enzymes to several bioactive lipophilic compounds (eicosanoids), including prostaglandins (PGs) and leukotrienes (LTs). The enzyme may be involved in several physiological processes including cell contraction, cell proliferation and pathological response. [provided by RefSeq, Aug 2013]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.