Human PLA2G1B/PLA2/PLA2A ORF/cDNA clone-Lentivirus plasmid (NM_000928)
SKU: pGMLP002399
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human PLA2G1B/PLA2/PLA2A Lentiviral expression plasmid for PLA2G1B lentivirus packaging, PLA2G1B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
PLA2G1B/PLA2 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP002399 |
Gene Name | PLA2G1B |
Accession Number | NM_000928 |
Gene ID | 5319 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 447 bp |
Gene Alias | PLA2,PLA2A,PPLA2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAACTCCTTGTGCTAGCTGTGCTGCTCACAGTGGCCGCCGCCGACAGCGGCATCAGCCCTCGGGCCGTGTGGCAGTTCCGCAAAATGATCAAGTGCGTGATCCCGGGGAGTGACCCCTTCTTGGAATACAACAACTACGGCTGCTACTGTGGCTTGGGGGGCTCAGGCACCCCCGTGGATGAACTGGACAAGTGCTGCCAGACACATGACAACTGCTATGACCAGGCCAAGAAGCTGGACAGCTGTAAATTTCTGCTGGACAACCCGTACACCCACACCTATTCATACTCGTGCTCTGGCTCGGCAATCACCTGTAGCAGCAAAAACAAAGAGTGTGAGGCCTTCATTTGCAACTGCGACCGCAACGCTGCCATCTGCTTTTCAAAAGCTCCATATAACAAGGCACACAAGAACCTGGACACCAAGAAGTATTGTCAGAGTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T31479-Ab | Anti-PA21B/ PLA2G1B/ PLA2 functional antibody |
Target Antigen | GM-Tg-g-T31479-Ag | PLA2G1B protein |
ORF Viral Vector | pGMLP002399 | Human PLA2G1B Lentivirus plasmid |
ORF Viral Vector | vGMLP002399 | Human PLA2G1B Lentivirus particle |
Target information
Target ID | GM-T31479 |
Target Name | PLA2G1B |
Gene ID | 5319, 18778, 696712, 29526, 101095522, 404011, 282457, 100050467 |
Gene Symbol and Synonyms | PLA2,PLA2A,PLA2G1B,PPLA2,sPLA2IB |
Uniprot Accession | P04054 |
Uniprot Entry Name | PA21B_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000170890 |
Target Classification | Not Available |
This gene encodes a secreted member of the phospholipase A2 (PLA2) class of enzymes, which is produced by the pancreatic acinar cells. The encoded calcium-dependent enzyme catalyzes the hydrolysis of the sn-2 position of membrane glycerophospholipids to release arachidonic acid (AA) and lysophospholipids. AA is subsequently converted by downstream metabolic enzymes to several bioactive lipophilic compounds (eicosanoids), including prostaglandins (PGs) and leukotrienes (LTs). The enzyme may be involved in several physiological processes including cell contraction, cell proliferation and pathological response. [provided by RefSeq, Aug 2013]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.