Human PPBP/B-TG1/Beta-TG ORF/cDNA clone-Lentivirus plasmid (NM_002704)

SKU: pGMLP002272
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PPBP/B-TG1/Beta-TG Lentiviral expression plasmid for PPBP lentivirus packaging, PPBP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf MSDS
pdf Datasheet
pdf Terms of Use
pdf Map
Target products collection

Go to PPBP/B-TG1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free


Product Description

Catalog ID pGMLP002272
Gene Name PPBP
Accession Number NM_002704
Gene ID 5473
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 387 bp
Gene Alias B-TG1,Beta-TG,CTAP-III,CTAP3,CTAPIII,CXCL7,LA-PF4,LDGF,MDGF,NAP-2,PBP,SCYB7,TC1,TC2,TGB,TGB1,THBGB,THBGB1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGCCTCAGACTTGATACCACCCCTTCCTGTAACAGTGCGAGACCACTTCATGCCTTGCAGGTGCTGCTGCTTCTGTCATTGCTGCTGACTGCTCTGGCTTCCTCCACCAAAGGACAAACTAAGAGAAACTTGGCGAAAGGCAAAGAGGAAAGTCTAGACAGTGACTTGTATGCTGAACTCCGCTGCATGTGTATAAAGACAACCTCTGGAATTCATCCCAAAAACATCCAAAGTTTGGAAGTGATCGGGAAAGGAACCCATTGCAACCAAGTCGAAGTGATAGCCACACTGAAGGATGGGAGGAAAATCTGCCTGGACCCAGATGCTCCCAGAATCAAGAAAATTGTACAGAAAAAATTGGCAGGTGATGAATCTGCTGATTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0421-Ab Anti-CXCL7/ PPBP/ B-TG1 functional antibody
    Target Antigen GM-Tg-g-SE0421-Ag PPBP protein
    Cytokine cks-Tg-g-GM-SE0421 pro-platelet basic protein (chemokine (C-X-C motif) ligand 7) (PPBP) protein & antibody
    ORF Viral Vector pGMLP002272 Human PPBP Lentivirus plasmid
    ORF Viral Vector vGMLP002272 Human PPBP Lentivirus particle


    Target information

    Target ID GM-SE0421
    Target Name PPBP
    Gene ID 5473, 703334, 101094344, 613723, 100055973
    Gene Symbol and Synonyms B-TG1,Beta-TG,CTAP-III,CTAP3,CTAPIII,CXCL7,LA-PF4,LDGF,MDGF,NAP-2,PBP,PPBP,SCYB7,TC1,TC2,TGB,TGB1,THBGB,THBGB1
    Uniprot Accession P02775
    Uniprot Entry Name CXCL7_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Ovary Cancer, Sepsis, Dent disease, Diabetes type-2
    Gene Ensembl ENSG00000163736
    Target Classification Not Available

    The protein encoded by this gene is a platelet-derived growth factor that belongs to the CXC chemokine family. This growth factor is a potent chemoattractant and activator of neutrophils. It has been shown to stimulate various cellular processes including DNA synthesis, mitosis, glycolysis, intracellular cAMP accumulation, prostaglandin E2 secretion, and synthesis of hyaluronic acid and sulfated glycosaminoglycan. It also stimulates the formation and secretion of plasminogen activator by synovial cells. The protein also is an antimicrobial protein with bactericidal and antifungal activity. [provided by RefSeq, Nov 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.