Human VEGFD/FIGF/VEGF-D ORF/cDNA clone-Lentivirus plasmid (NM_004469)
Cat. No.: pGMLP002231
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human VEGFD/FIGF/VEGF-D Lentiviral expression plasmid for VEGFD lentivirus packaging, VEGFD lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
VEGFD/FIGF products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP002231 |
Gene Name | VEGFD |
Accession Number | NM_004469 |
Gene ID | 2277 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1065 bp |
Gene Alias | FIGF,VEGF-D |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGTACAGAGAGTGGGTAGTGGTGAATGTTTTCATGATGTTGTACGTCCAGCTGGTGCAGGGCTCCAGTAATGAACATGGACCAGTGAAGCGATCATCTCAGTCCACATTGGAACGATCTGAACAGCAGATCAGGGCTGCTTCTAGTTTGGAGGAACTACTTCGAATTACTCACTCTGAGGACTGGAAGCTGTGGAGATGCAGGCTGAGGCTCAAAAGTTTTACCAGTATGGACTCTCGCTCAGCATCCCATCGGTCCACTAGGTTTGCGGCAACTTTCTATGACATTGAAACACTAAAAGTTATAGATGAAGAATGGCAAAGAACTCAGTGCAGCCCTAGAGAAACGTGCGTGGAGGTGGCCAGTGAGCTGGGGAAGAGTACCAACACATTCTTCAAGCCCCCTTGTGTGAACGTGTTCCGATGTGGTGGCTGTTGCAATGAAGAGAGCCTTATCTGTATGAACACCAGCACCTCGTACATTTCCAAACAGCTCTTTGAGATATCAGTGCCTTTGACATCAGTACCTGAATTAGTGCCTGTTAAAGTTGCCAATCATACAGGTTGTAAGTGCTTGCCAACAGCCCCCCGCCATCCATACTCAATTATCAGAAGATCCATCCAGATCCCTGAAGAAGATCGCTGTTCCCATTCCAAGAAACTCTGTCCTATTGACATGCTATGGGATAGCAACAAATGTAAATGTGTTTTGCAGGAGGAAAATCCACTTGCTGGAACAGAAGACCACTCTCATCTCCAGGAACCAGCTCTCTGTGGGCCACACATGATGTTTGACGAAGATCGTTGCGAGTGTGTCTGTAAAACACCATGTCCCAAAGATCTAATCCAGCACCCCAAAAACTGCAGTTGCTTTGAGTGCAAAGAAAGTCTGGAGACCTGCTGCCAGAAGCACAAGCTATTTCACCCAGACACCTGCAGCTGTGAGGACAGATGCCCCTTTCATACCAGACCATGTGCAAGTGGCAAAACAGCATGTGCAAAGCATTGCCGCTTTCCAAAGGAGAAAAGGGCTGCCCAGGGGCCCCACAGCCGAAAGAATCCTTGA |
ORF Protein Sequence | MYREWVVVNVFMMLYVQLVQGSSNEHGPVKRSSQSTLERSEQQIRAASSLEELLRITHSEDWKLWRCRLRLKSFTSMDSRSASHRSTRFAATFYDIETLKVIDEEWQRTQCSPRETCVEVASELGKSTNTFFKPPCVNVFRCGGCCNEESLICMNTSTSYISKQLFEISVPLTSVPELVPVKVANHTGCKCLPTAPRHPYSIIRRSIQIPEEDRCSHSKKLCPIDMLWDSNKCKCVLQEENPLAGTEDHSHLQEPALCGPHMMFDEDRCECVCKTPCPKDLIQHPKNCSCFECKESLETCCQKHKLFHPDTCSCEDRCPFHTRPCASGKTACAKHCRFPKEKRAAQGPHSRKNP |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T63803-Ab | Anti-VEGFD/ FIGF/ VEGF-D functional antibody |
Target Antigen | GM-Tg-g-T63803-Ag | VEGFD protein |
Cytokine | cks-Tg-g-GM-T63803 | c-fos induced growth factor (vascular endothelial growth factor D) (FIGF) protein & antibody |
ORF Viral Vector | pGMLP002231 | Human VEGFD Lentivirus plasmid |
ORF Viral Vector | vGMLP002231 | Human VEGFD Lentivirus particle |
Target information
Target ID | GM-T63803 |
Target Name | VEGFD |
Gene ID | 2277, 14205, 712654, 360457, 493703, 491749, 286799, 100050877 |
Gene Symbol and Synonyms | FIGF,VEGF-D,VEGFD |
Uniprot Accession | O43915 |
Uniprot Entry Name | VEGFD_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Breast Cancer |
Gene Ensembl | ENSG00000165197 |
Target Classification | Not Available |
The protein encoded by this gene is a member of the platelet-derived growth factor/vascular endothelial growth factor (PDGF/VEGF) family and is active in angiogenesis, lymphangiogenesis, and endothelial cell growth. This secreted protein undergoes a complex proteolytic maturation, generating multiple processed forms which bind and activate VEGFR-2 and VEGFR-3 receptors. This protein is structurally and functionally similar to vascular endothelial growth factor C. Read-through transcription has been observed between this locus and the upstream PIR (GeneID 8544) locus. [provided by RefSeq, Feb 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.