Human TUFT1 ORF/cDNA clone-Lentivirus plasmid (NM_020127)
SKU: pGMLP002211
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human TUFT1/ Lentiviral expression plasmid for TUFT1 lentivirus packaging, TUFT1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
TUFT1/ products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP002211 |
Gene Name | TUFT1 |
Accession Number | NM_020127 |
Gene ID | 7286 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1173 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAACGGGACGCGGAACTGGTGTACCCTGGTGGACGTGCACCCAGAGGACCAGGCGGCGGGCAGCGTGGACATTCTCAGGCTGACTCTCCAGGGTGAACTGACAGGAGATGAACTTGAACACATAGCCCAGAAGGCGGGCAGGAAGACCTATGCCATGGTGTCCAGCCACTCAGCTGGTCATTCTCTGGCTTCAGAACTGGTGGAGTCCCATGATGGACATGAGGAGATCATTAAGGTGTACTTGAAGGGGAGGTCTGGAGACAAGATGATTCACGAGAAGAATATTAACCAGCTGAAGAGTGAGGTCCAGTACATCCAGGAGGCCAGGAACTGCCTACAGAAGCTCCGGGAGGATATAAGTAGCAAGCTTGACAGGAACCTAGGAGATTCTCTCCATCGACAGGAGATACAGGTGGTGCTAGAAAAGCCAAATGGCTTTAGTCAGAGTCCCACAGCCCTGTACAGCAGCCCACCTGAGGTGGACACCTGTATAAATGAGGATGTTGAGAGCTTGAGGAAGACGGTGCAGGACTTGCTGGCCAAGCTTCAGGAGGCCAAGCGGCAACACCAGTCAGACTGTGTGGCTTTTGAGGTCACACTCAGCCGGTACCAGAGGGAAGCAGAACAAAGTAATGTGGCCCTTCAGAGAGAGGAGGACAGAGTGGAGCAGAAAGAGGCAGAAGTCGGAGAGCTGCAGAGGCGCTTGCTAGGGATGGAGACGGAGCATCAGGCCTTACTGGCGAAAGTGAGGGAAGGGGAGGTGGCCCTAGAGGAACTTCGGAGCAACAATGCTGACTGCCAAGCAGAACGAGAAAAGGCTGCTACCCTGGAAAAGGAAGTGGCCGGGTTGCGGGAGAAGATCCACCACTTGGATGACATGCTCAAGAGCCAGCAGCGGAAAGTCCGGCAAATGATAGAGCAGCTCCAGAATTCAAAAGCTGTGATCCAGTCAAAGGACGCCACCATCCAGGAGCTCAAGGAGAAAATCGCCTATCTGGAGGCAGAGAATTTAGAGATGCATGACCGGATGGAACACCTGATAGAAAAACAAATCAGTCATGGCAACTTCAGCACCCAGGCCCGGGCCAAGACAGAGAACCCGGGCAGTATTAGGATATCCAAGCCGCCTAGCCCGAAGCCCATGCCTGTCATCCGAGTGGTGGAAACCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1352-Ab | Anti-TUFT1 functional antibody |
Target Antigen | GM-Tg-g-SE1352-Ag | TUFT1 protein |
ORF Viral Vector | pGMLP002211 | Human TUFT1 Lentivirus plasmid |
ORF Viral Vector | vGMLP002211 | Human TUFT1 Lentivirus particle |
Target information
Target ID | GM-SE1352 |
Target Name | TUFT1 |
Gene ID | 7286, 22156, 716814, 365864, 101101244, 483199, 282104, 100059946 |
Gene Symbol and Synonyms | TUFT1,WHSF |
Uniprot Accession | Q9NNX1 |
Uniprot Entry Name | TUFT1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000143367 |
Target Classification | Not Available |
Tuftelin is an acidic protein that is thought to play a role in dental enamel mineralization and is implicated in caries susceptibility. It is also thought to be involved with adaptation to hypoxia, mesenchymal stem cell function, and neurotrophin nerve growth factor mediated neuronal differentiation. [provided by RefSeq, Aug 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.