Human TIMP2/CSC-21K/ DDC8 ORF/cDNA clone-Lentivirus plasmid (NM_003255.4)
Pre-made Human TIMP2/CSC-21K/ DDC8 Lentiviral expression plasmid for TIMP2 lentivirus packaging, TIMP2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to TIMP2/CSC-21K products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002009 | Human TIMP2 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002009 |
Gene Name | TIMP2 |
Accession Number | NM_003255.4 |
Gene ID | 7077 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 663 bp |
Gene Alias | CSC-21K, DDC8 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGCGCCGCGGCCCGCACCCTGCGGCTGGCGCTCGGCCTCCTGCTGCTGGCGACGCTGCTTCGCCCGGCCGACGCCTGCAGCTGCTCCCCGGTGCACCCGCAACAGGCGTTTTGCAATGCAGATGTAGTGATCAGGGCCAAAGCGGTCAGTGAGAAGGAAGTGGACTCTGGAAACGACATTTATGGCAACCCTATCAAGAGGATCCAGTATGAGATCAAGCAGATAAAGATGTTCAAAGGGCCTGAGAAGGATATAGAGTTTATCTACACGGCCCCCTCCTCGGCAGTGTGTGGGGTCTCGCTGGACGTTGGAGGAAAGAAGGAATATCTCATTGCAGGAAAGGCCGAGGGGGACGGCAAGATGCACATCACCCTCTGTGACTTCATCGTGCCCTGGGACACCCTGAGCACCACCCAGAAGAAGAGCCTGAACCACAGGTACCAGATGGGCTGCGAGTGCAAGATCACGCGCTGCCCCATGATCCCGTGCTACATCTCCTCCCCGGACGAGTGCCTCTGGATGGACTGGGTCACAGAGAAGAACATCAACGGGCACCAGGCCAAGTTCTTCGCCTGCATCAAGAGAAGTGACGGCTCCTGTGCGTGGTACCGCGGCGCGGCGCCCCCCAAGCAGGAGTTTCTCGACATCGAGGACCCATAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1338-Ab | Anti-TIMP2/ CSC-21K/ DDC8 functional antibody |
Target Antigen | GM-Tg-g-SE1338-Ag | TIMP2 protein |
ORF Viral Vector | pGMLP002009 | Human TIMP2 Lentivirus plasmid |
ORF Viral Vector | vGMLP002009 | Human TIMP2 Lentivirus particle |
Target information
Target ID | GM-SE1338 |
Target Name | TIMP2 |
Gene ID | 7077, 21858, 574357, 29543, 101083125, 403633, 282093, 100034134 |
Gene Symbol and Synonyms | CSC-21K,D11Bwg1104e,DDC8,Timp-2,TIMP2 |
Uniprot Accession | P16035 |
Uniprot Entry Name | TIMP2_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Acute kidney failure, Dent disease, Malignant neoplasm of bladder |
Gene Ensembl | ENSG00000035862 |
Target Classification | Not Available |
This gene is a member of the TIMP gene family. The proteins encoded by this gene family are natural inhibitors of the matrix metalloproteinases, a group of peptidases involved in degradation of the extracellular matrix. In addition to an inhibitory role against metalloproteinases, the encoded protein has a unique role among TIMP family members in its ability to directly suppress the proliferation of endothelial cells. As a result, the encoded protein may be critical to the maintenance of tissue homeostasis by suppressing the proliferation of quiescent tissues in response to angiogenic factors, and by inhibiting protease activity in tissues undergoing remodelling of the extracellular matrix. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.