Human TNFSF11/CD254/hRANKL2 ORF/cDNA clone-Lentivirus plasmid (NM_003701.3 )
SKU: pGMLP001907
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human TNFSF11/CD254/hRANKL2 Lentiviral expression plasmid for TNFSF11 lentivirus packaging, TNFSF11 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
ODF/TNFSF11/CD254 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP001907 |
Gene Name | TNFSF11 |
Accession Number | NM_003701.3 |
Gene ID | 8600 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 954 bp |
Gene Alias | CD254,hRANKL2,ODF,OPGL,OPTB2,RANKL,sOdf,TNLG6B,TRANCE |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCGCCGCGCCAGCAGAGACTACACCAAGTACCTGCGTGGCTCGGAGGAGATGGGCGGCGGCCCCGGAGCCCCGCACGAGGGCCCCCTGCACGCCCCGCCGCCGCCTGCGCCGCACCAGCCCCCTGCCGCCTCCCGCTCCATGTTCGTGGCCCTCCTGGGGCTGGGGCTGGGCCAGGTTGTCTGCAGCGTCGCCCTGTTCTTCTATTTCAGAGCGCAGATGGATCCTAATAGAATATCAGAAGATGGCACTCACTGCATTTATAGAATTTTGAGACTCCATGAAAATGCAGATTTTCAAGACACAACTCTGGAGAGTCAAGATACAAAATTAATACCTGATTCATGTAGGAGAATTAAACAGGCCTTTCAAGGAGCTGTGCAAAAGGAATTACAACATATCGTTGGATCACAGCACATCAGAGCAGAGAAAGCGATGGTGGATGGCTCATGGTTAGATCTGGCCAAGAGGAGCAAGCTTGAAGCTCAGCCTTTTGCTCATCTCACTATTAATGCCACCGACATCCCATCTGGTTCCCATAAAGTGAGTCTGTCCTCTTGGTACCATGATCGGGGTTGGGCCAAGATCTCCAACATGACTTTTAGCAATGGAAAACTAATAGTTAATCAGGATGGCTTTTATTACCTGTATGCCAACATTTGCTTTCGACATCATGAAACTTCAGGAGACCTAGCTACAGAGTATCTTCAACTAATGGTGTACGTCACTAAAACCAGCATCAAAATCCCAAGTTCTCATACCCTGATGAAAGGAGGAAGCACCAAGTATTGGTCAGGGAATTCTGAATTCCATTTTTATTCCATAAACGTTGGTGGATTTTTTAAGTTACGGTCTGGAGAGGAAATCAGCATCGAGGTCTCCAACCCCTCCTTACTGGATCCGGATCAGGATGCAACATACTTTGGGGCTTTTAAAGTTCGAGATATAGATTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-140 | Pre-Made Denosumab biosimilar, Whole mAb, Anti-TNFSF11/ODF Antibody: Anti-OPGL/sCD254/OPTB2/RANKL/TNLG6B/TRANCE/hRANKL2 therapeutic antibody |
Target Antibody | GM-Tg-g-T21334-Ab | Anti-TNF11/ ODF/ TNFSF11 monoclonal antibody |
Target Antigen | GM-Tg-g-T21334-Ag | ODF/TNFSF11 VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-T21334 | tumor necrosis factor (ligand) superfamily, member 11 (TNFSF11) protein & antibody |
ORF Viral Vector | pGMLP001907 | Human TNFSF11 Lentivirus plasmid |
ORF Viral Vector | vGMLP001907 | Human TNFSF11 Lentivirus particle |
Target information
Target ID | GM-T21334 |
Target Name | ODF |
Gene ID | 8600, 21943, 699955, 117516, 724036, 609418, 513836, 100060254 |
Gene Symbol and Synonyms | CD254,hRANKL2,Ly109l,ODF,OPGL,OPTB2,RANKL,sOdf,TNFSF11,TNLG6B,TRANCE |
Uniprot Accession | O14788 |
Uniprot Entry Name | TNF11_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000120659 |
Target Classification | Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA) |
This gene encodes a member of the tumor necrosis factor (TNF) cytokine family which is a ligand for osteoprotegerin and functions as a key factor for osteoclast differentiation and activation. This protein was shown to be a dentritic cell survival factor and is involved in the regulation of T cell-dependent immune response. T cell activation was reported to induce expression of this gene and lead to an increase of osteoclastogenesis and bone loss. This protein was shown to activate antiapoptotic kinase AKT/PKB through a signaling complex involving SRC kinase and tumor necrosis factor receptor-associated factor (TRAF) 6, which indicated this protein may have a role in the regulation of cell apoptosis. Targeted disruption of the related gene in mice led to severe osteopetrosis and a lack of osteoclasts. The deficient mice exhibited defects in early differentiation of T and B lymphocytes, and failed to form lobulo-alveolar mammary structures during pregnancy. Two alternatively spliced transcript variants have been found. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.