Human TNFSF11/CD254/hRANKL2 ORF/cDNA clone-Lentivirus plasmid (NM_003701.3 )

SKU: pGMLP001907
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TNFSF11/CD254/hRANKL2 Lentiviral expression plasmid for TNFSF11 lentivirus packaging, TNFSF11 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf MSDS
pdf Datasheet
pdf Terms of Use
pdf Map
Target products collection

Go to ODF/TNFSF11/CD254 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $538.5
Shipping fee: Limited-time free


Product Description

Catalog ID pGMLP001907
Gene Name TNFSF11
Accession Number NM_003701.3
Gene ID 8600
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 954 bp
Gene Alias CD254,hRANKL2,ODF,OPGL,OPTB2,RANKL,sOdf,TNLG6B,TRANCE
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCGCCGCGCCAGCAGAGACTACACCAAGTACCTGCGTGGCTCGGAGGAGATGGGCGGCGGCCCCGGAGCCCCGCACGAGGGCCCCCTGCACGCCCCGCCGCCGCCTGCGCCGCACCAGCCCCCTGCCGCCTCCCGCTCCATGTTCGTGGCCCTCCTGGGGCTGGGGCTGGGCCAGGTTGTCTGCAGCGTCGCCCTGTTCTTCTATTTCAGAGCGCAGATGGATCCTAATAGAATATCAGAAGATGGCACTCACTGCATTTATAGAATTTTGAGACTCCATGAAAATGCAGATTTTCAAGACACAACTCTGGAGAGTCAAGATACAAAATTAATACCTGATTCATGTAGGAGAATTAAACAGGCCTTTCAAGGAGCTGTGCAAAAGGAATTACAACATATCGTTGGATCACAGCACATCAGAGCAGAGAAAGCGATGGTGGATGGCTCATGGTTAGATCTGGCCAAGAGGAGCAAGCTTGAAGCTCAGCCTTTTGCTCATCTCACTATTAATGCCACCGACATCCCATCTGGTTCCCATAAAGTGAGTCTGTCCTCTTGGTACCATGATCGGGGTTGGGCCAAGATCTCCAACATGACTTTTAGCAATGGAAAACTAATAGTTAATCAGGATGGCTTTTATTACCTGTATGCCAACATTTGCTTTCGACATCATGAAACTTCAGGAGACCTAGCTACAGAGTATCTTCAACTAATGGTGTACGTCACTAAAACCAGCATCAAAATCCCAAGTTCTCATACCCTGATGAAAGGAGGAAGCACCAAGTATTGGTCAGGGAATTCTGAATTCCATTTTTATTCCATAAACGTTGGTGGATTTTTTAAGTTACGGTCTGGAGAGGAAATCAGCATCGAGGTCTCCAACCCCTCCTTACTGGATCCGGATCAGGATGCAACATACTTTGGGGCTTTTAAAGTTCGAGATATAGATTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-140 Pre-Made Denosumab biosimilar, Whole mAb, Anti-TNFSF11/ODF Antibody: Anti-OPGL/sCD254/OPTB2/RANKL/TNLG6B/TRANCE/hRANKL2 therapeutic antibody
    Target Antibody GM-Tg-g-T21334-Ab Anti-TNF11/ ODF/ TNFSF11 monoclonal antibody
    Target Antigen GM-Tg-g-T21334-Ag ODF/TNFSF11 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T21334 tumor necrosis factor (ligand) superfamily, member 11 (TNFSF11) protein & antibody
    ORF Viral Vector pGMLP001907 Human TNFSF11 Lentivirus plasmid
    ORF Viral Vector vGMLP001907 Human TNFSF11 Lentivirus particle


    Target information

    Target ID GM-T21334
    Target Name ODF
    Gene ID 8600, 21943, 699955, 117516, 724036, 609418, 513836, 100060254
    Gene Symbol and Synonyms CD254,hRANKL2,Ly109l,ODF,OPGL,OPTB2,RANKL,sOdf,TNFSF11,TNLG6B,TRANCE
    Uniprot Accession O14788
    Uniprot Entry Name TNF11_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000120659
    Target Classification Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA)

    This gene encodes a member of the tumor necrosis factor (TNF) cytokine family which is a ligand for osteoprotegerin and functions as a key factor for osteoclast differentiation and activation. This protein was shown to be a dentritic cell survival factor and is involved in the regulation of T cell-dependent immune response. T cell activation was reported to induce expression of this gene and lead to an increase of osteoclastogenesis and bone loss. This protein was shown to activate antiapoptotic kinase AKT/PKB through a signaling complex involving SRC kinase and tumor necrosis factor receptor-associated factor (TRAF) 6, which indicated this protein may have a role in the regulation of cell apoptosis. Targeted disruption of the related gene in mice led to severe osteopetrosis and a lack of osteoclasts. The deficient mice exhibited defects in early differentiation of T and B lymphocytes, and failed to form lobulo-alveolar mammary structures during pregnancy. Two alternatively spliced transcript variants have been found. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.