Human ORAI1/CRACM1/IMD9 ORF/cDNA clone-Lentivirus plasmid (NM_032790.3)

Cat. No.: pGMLP001896
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human ORAI1/CRACM1/IMD9 Lentiviral expression plasmid for ORAI1 lentivirus packaging, ORAI1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to CRACM/ORAI1/CRACM1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $526.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001896
Gene Name ORAI1
Accession Number NM_032790.3
Gene ID 84876
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 906 bp
Gene Alias CRACM1,IMD9,ORAT1,TAM2,TMEM142A
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCATCCGGAGCCCGCCCCGCCCCCGAGCCGCAGCAGTCCCGAGCTTCCCCCAAGCGGCGGCAGCACCACCAGCGGCAGCCGCCGGAGCCGCCGCCGCAGCGGGGACGGGGAGCCCCCGGGGGCCCCGCCACCGCCGCCGTCCGCCGTCACCTACCCGGACTGGATCGGCCAGAGTTACTCCGAGGTGATGAGCCTCAACGAGCACTCCATGCAGGCGCTGTCCTGGCGCAAGCTCTACTTGAGCCGCGCCAAGCTTAAAGCCTCCAGCCGGACCTCGGCTCTGCTCTCCGGCTTCGCCATGGTGGCAATGGTGGAGGTGCAGCTGGACGCTGACCACGACTACCCACCGGGGCTGCTCATCGCCTTCAGTGCCTGCACCACAGTGCTGGTGGCTGTGCACCTGTTTGCGCTCATGATCAGCACCTGCATCCTGCCCAACATCGAGGCGGTGAGCAACGTGCACAATCTCAACTCGGTCAAGGAGTCCCCCCATGAGCGCATGCACCGCCACATCGAGCTGGCCTGGGCCTTCTCCACCGTCATCGGCACGCTGCTCTTCCTAGCTGAGGTGGTGCTGCTCTGCTGGGTCAAGTTCTTGCCCCTCAAGAAGCAGCCAGGCCAGCCAAGGCCCACCAGCAAGCCCCCCGCCAGTGGCGCAGCAGCCAACGTCAGCACCAGCGGCATCACCCCGGGCCAGGCAGCTGCCATCGCCTCGACCACCATCATGGTGCCCTTCGGCCTGATCTTTATCGTCTTCGCCGTCCACTTCTACCGCTCACTGGTTAGCCATAAGACTGACCGACAGTTCCAGGAGCTCAACGAGCTGGCGGAGTTTGCCCGCTTACAGGACCAGCTGGACCACAGAGGGGACCACCCCCTGACGCCCGGCAGCCACTATGCCTAG
ORF Protein Sequence MHPEPAPPPSRSSPELPPSGGSTTSGSRRSRRRSGDGEPPGAPPPPPSAVTYPDWIGQSYSEVMSLNEHSMQALSWRKLYLSRAKLKASSRTSALLSGFAMVAMVEVQLDADHDYPPGLLIAFSACTTVLVAVHLFALMISTCILPNIEAVSNVHNLNSVKESPHERMHRHIELAWAFSTVIGTLLFLAEVVLLCWVKFLPLKKQPGQPRPTSKPPASGAAANVSTSGITPGQAAAIASTTIMVPFGLIFIVFAVHFYRSLVSHKTDRQFQELNELAEFARLQDQLDHRGDHPLTPGSHYA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T30790-Ab Anti-CRCM1/ CRACM/ ORAI1 monoclonal antibody
    Target Antigen GM-Tg-g-T30790-Ag CRACM/ORAI1 VLP (virus-like particle)
    ORF Viral Vector pGMLP001896 Human ORAI1 Lentivirus plasmid
    ORF Viral Vector vGMLP001896 Human ORAI1 Lentivirus particle


    Target information

    Target ID GM-T30790
    Target Name CRACM
    Gene ID 84876, 109305, 700190, 304496, 101096922, 486261, 517688, 100059726
    Gene Symbol and Synonyms CRACM1,D730049H07Rik,IMD9,orai-1,ORAI1,ORAT1,RGD1311873,TAM2,TMEM142A
    Uniprot Accession Q96D31
    Uniprot Entry Name CRCM1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000276045
    Target Classification Not Available

    The protein encoded by this gene is a membrane calcium channel subunit that is activated by the calcium sensor STIM1 when calcium stores are depleted. This type of channel is the primary way for calcium influx into T-cells. Defects in this gene are a cause of immune dysfunction with T-cell inactivation due to calcium entry defect type 1 (IDTICED1). [provided by RefSeq, Sep 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.